Dataset for CDS Unclassified of organism Strongylocentrotus purpuratus

[Download (right click)]

8 sequence(s)

>gnl|bcl2dbcds|A0A7M7GIY1_uncBCL2L1-03 Putative BCL2-like 1 gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=750 residues).
atggcaagagatgaaatgaataagatgaatgatagtgaaaccactaaactgattgaggattactgcatacacaggatacg
aaaggagagcatcgaacttgcgtcttaccaacatgtgagcagagagccctatgctcccgtcgcagccagaatgagagaaa
taggtgaagaaatcgagagaacaaatccagactttttttctgggtgttgcgaggagctgaacatcagcgaaaccacggcc
tacgccaaattcaaagacttagcggacgagcttttcaaggaccaagagaacggatcgagaggtgtaacatggggaaggat
agcagctttaatagcgttcagcggccgactttctgtacattgtgctagtaataacttagaagacttagttcccagtatta
taggctggacatccagatacattggcagtaaattattaccgtggatgcaagaccatcaaaattgggatgggttcatggca
ttttttgaggagaatggcaaagtccgggcgagggaaaccgtctcgtcgatcatgtcgtcggcgtgccgcttcgcagtttt
cggcgcgggaatcgcagccctcgcttgcctactcagaaggatccaaaaggatggcttcatggatttctttgatcgcaatc
aagcagctgaacgagctcaagaatctctcacaaaatttgtccggtctgcatgcggctatgccgtggtgggcgccggaatc
gcagcactgggcatgttcctacgcaggtga
>gnl|bcl2dbcds|A0A7M7GIY1_uncBCL2L1-04 Putative BCL2-like 1 gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=765 residues).
atggcaagagatgaaatgaataagatgaatgatagtgaaaccactaaactgattgaggattactgcatacacaggatacg
aaaggagagcatcgaacttgcgtcttaccaacatgtgagcagagagccctatgctcccgtcgcagccagaatgagagaaa
taggtgaagaaatcgagagaacaaatccagactttttttctgggtgttgcgaggagctgaacatcagcgaaaccacggcc
tacgccaaattcaaagacttagcggacgagcttttcaaggaccaagagaacggatcgagaggtaaaggtgtgaaaagtgt
aacatggggaaggatagcagctttaatagcgttcagcggccgactttctgtacattgtgctagtaataacttagaagact
tagttcccagtattataggctggacatccagatacattggcagtaaattattaccgtggatgcaagaccatcaaaattgg
gatgggttcatggcattttttgaggagaatggcaaagtccgggcgagggaaaccgtctcgtcgatcatgtcgtcggcgtg
ccgcttcgcagttttcggcgcgggaatcgcagccctcgcttgcctactcagaaggatccaaaaggatggcttcatggatt
tctttgatcgcaatcaagcagctgaacgagctcaagaatctctcacaaaatttgtccggtctgcatgcggctatgccgtg
gtgggcgccggaatcgcagcactgggcatgttcctacgcaggtga
>gnl|bcl2dbcds|A0A7M7GIY1_uncBCL2L1-05 Putative BCL2-like 1 gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=606 residues).
atggcaagagatgaaatgaataagatgaatgatagtgaaaccactaaactgattgaggattactgcatacacaggatacg
aaaggagagcatcgaacttgcgtcttaccaacatgtgagcagagagccctatgctcccgtcgcagccagaatgagagaaa
taggtgaagaaatcgagagaacaaatccagactttttttctgggtgttgcgaggagctgaacatcagcgaaaccacggcc
tacgccaaattcaaagacttagcggacgagcttttcaaggaccaagagaacggatcgagaggtgtaacatggggaaggat
agcagctttaatagcgttcagcggccgactttctgtacattgtgctagtaataacttagaagacttagttcccagtatta
taggctggacatccagatacattggcagtaaattattaccgtggatgcaagaccatcaaaattgggatggcttcatggat
ttctttgatcgcaatcaagcagctgaacgagctcaagaatctctcacaaaatttgtccggtctgcatgcggctatgccgt
ggtgggcgccggaatcgcagcactgggcatgttcctacgcaggtga
>gnl|bcl2dbcds|A0A7M7GIY1_uncBCL2L1-06 Putative BCL2-like 1 gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=756 residues).
atggcaagagatgaaatgaataagatgaatgatagtgaaaccactaaactgattgaggattactgcatacacaggatacg
aaaggagagcatcgaacttgcgtcttaccaacatgtgagcagagagccctatgctcccgtcgcagccagaatgagagaaa
taggtgaagaaatcgagagaacaaatccagactttttttctgggtgttgcgaggagctgaacatcagcgaaaccacggcc
tacgccaaattcaaagacttagcggacgagcttttcaaggaccaagagaacggatcgagaggtaaaggtgtaacatgggg
aaggatagcagctttaatagcgttcagcggccgactttctgtacattgtgctagtaataacttagaagacttagttccca
gtattataggctggacatccagatacattggcagtaaattattaccgtggatgcaagaccatcaaaattgggatgggttc
atggcattttttgaggagaatggcaaagtccgggcgagggaaaccgtctcgtcgatcatgtcgtcggcgtgccgcttcgc
agttttcggcgcgggaatcgcagccctcgcttgcctactcagaaggatccaaaaggatggcttcatggatttctttgatc
gcaatcaagcagctgaacgagctcaagaatctctcacaaaatttgtccggtctgcatgcggctatgccgtggtgggcgcc
ggaatcgcagcactgggcatgttcctacgcaggtga
>gnl|bcl2dbcds|A0A7M7GIY1_uncBCL2L1-07 Putative BCL2-like 1 gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=621 residues).
atggcaagagatgaaatgaataagatgaatgatagtgaaaccactaaactgattgaggattactgcatacacaggatacg
aaaggagagcatcgaacttgcgtcttaccaacatgtgagcagagagccctatgctcccgtcgcagccagaatgagagaaa
taggtgaagaaatcgagagaacaaatccagactttttttctgggtgttgcgaggagctgaacatcagcgaaaccacggcc
tacgccaaattcaaagacttagcggacgagcttttcaaggaccaagagaacggatcgagaggtaaaggtgtgaaaagtgt
aacatggggaaggatagcagctttaatagcgttcagcggccgactttctgtacattgtgctagtaataacttagaagact
tagttcccagtattataggctggacatccagatacattggcagtaaattattaccgtggatgcaagaccatcaaaattgg
gatggcttcatggatttctttgatcgcaatcaagcagctgaacgagctcaagaatctctcacaaaatttgtccggtctgc
atgcggctatgccgtggtgggcgccggaatcgcagcactgggcatgttcctacgcaggtga
>gnl|bcl2dbcds|A0A7M7GIY1_uncBCL2L1-08 Putative BCL2-like 1 gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=741 residues).
atgaatgatagtgaaaccactaaactgattgaggattactgcatacacaggatacgaaaggagagcatcgaacttgcgtc
ttaccaacatgtgagcagagagccctatgctcccgtcgcagccagaatgagagaaataggtgaagaaatcgagagaacaa
atccagactttttttctgggtgttgcgaggagctgaacatcagcgaaaccacggcctacgccaaattcaaagacttagcg
gacgagcttttcaaggaccaagagaacggatcgagaggtaaaggtgtgaaaagtgtaacatggggaaggatagcagcttt
aatagcgttcagcggccgactttctgtacattgtgctagtaataacttagaagacttagttcccagtattataggctgga
catccagatacattggcagtaaattattaccgtggatgcaagaccatcaaaattgggatgggttcatggcattttttgag
gagaatggcaaagtccgggcgagggaaaccgtctcgtcgatcatgtcgtcggcgtgccgcttcgcagttttcggcgcggg
aatcgcagccctcgcttgcctactcagaaggatccaaaaggatggcttcatggatttctttgatcgcaatcaagcagctg
aacgagctcaagaatctctcacaaaatttgtccggtctgcatgcggctatgccgtggtgggcgccggaatcgcagcactg
ggcatgttcctacgcaggtga
>gnl|bcl2dbcds|A0A7M7RC53_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=768 residues).
atgagtgaggaagaccgaaaaacggaaggggagtcgggcatatggtgctgtcttggatggtctggtggatgtgatagagc
tccaaatacaaatatgactgaatcaattcttgccgcttcttcgcctcagaaaagcaactacaacaagcagttgggccaaa
acttgtttttcaatggaaatgttagaaaggaacagccacccagccctgatgaagaagtgaatggacatcctcttgtggag
gaaggcgagtcggggttaattgctcgacagcttggggacgattacatttcatacaaagttggaaaacaacatggtcgccg
accgccttgccagcatgcagagacattaaggagagttggggatgaagttgaggaaagatacgccatcaccctcaatggtt
tagtgaacaatttggagtatgatccggacaaagatggtgaagaggcatttactgcgagtttgaatgccatgtttgaagaa
gggtcatgtaactggggacgtgttgttatggtttatgtttttgcagcccgtctcgcgaaatattgccaggaaaatggaaa
aggttatcacgtaggaagcttggcagattttgctggaagatatgttgcatcaaggttaaccccctggattaataagcaag
gaggatgggaaaagtttgatgaaagtttcaaggccaaagactggaaagaaaaggcagcattcaactcgttgttagtgaca
ggggcttttcttggtggacttgccgcgctcagactattgatgaaatag
>gnl|bcl2dbcds|A0A7M7T0Z6_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=597 residues).
atgccagatatcagcacagcaagcatagttgcagattatctacgttacagactgcaatgtttgggaaatggtgttgatgc
agaggaaaatgattgcttgtcaaccatcatgtcatcagtcgaaaatgttccagaggatcttcatgaagccatcgtaaatc
tctccgaaaaactcatgaatgactacagagattctttcagtgatatgccaaatcaactgaaaattactgaaaatactatc
agttcgacatttaaggccgttacaagtgagctttttgtagatggtgttatttcttggggacgaattgtagcatttttctc
tttcggaggagccctgtgcgagtggtgtcaagagaaggacatcccccgggcgttccccacggttgaagagctgatggtcg
cctacatcaattctcatctcatcacatggattcatgcgaatggcggatgggatggcttggtggatttctacaagcatctc
tctcattcatccctggatgactctgctctcaccaacggagtctggagtgggaaacagcttgtcggcgtggcaacgctagg
tatcctgacagtcggtgcattcttcttccgatcgtga
© 1998-2023Legal notice