Dataset for CDS BCL-2-like of organism Xenopus laevis

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


B6V6J0_MCL1-01        atgatgcaccagtcagtaattgccaagcagcgcccctcgactagtttcct
Q6GP82_BCL2L2-01      atggcgcagt----------------------------------------
B9ZYL7_BCL2-01        atggctcatc----------------------------------------
Q90ZH2_BCL2L1-01      atgg----------------------------------------------
Q2TAP5_BCL2L1-01      atgg----------------------------------------------
Q91828_BCL2L1-01      atgg----------------------------------------------
                      ***                                               

B6V6J0_MCL1-01        cattccctgccagttttactgctcgggcggcggctcctcagagaagacat
Q6GP82_BCL2L2-01      ---------------------ctgacctaggag---------cccgggct
B9ZYL7_BCL2-01        ---------------------ctagaagaggaggctatgatcaccgggac
Q90ZH2_BCL2L1-01      -----------------------agggcagcag----------tagagat
Q2TAP5_BCL2L1-01      -----------------------agggcagcag----------tagagat
Q91828_BCL2L1-01      -----------------------agggcagcag----------tagagat
                                                   *  *            *    

B6V6J0_MCL1-01        tgagcgcgcgtggggcttctccgtggga-----ccccgatatggacacgc
Q6GP82_BCL2L2-01      ttggtg---gaggattttgtgcggtacaagttatgccaacgtagtcttgt
B9ZYL7_BCL2-01        atagtg---gtaaaatatatccattataaactatctcagaaggggtatgc
Q90ZH2_BCL2L1-01      ctggtg---gagaagtttgttagtaagaaactttcccagaatg-------
Q2TAP5_BCL2L1-01      ctggtg---gagaagtttgttagtaagaaactttcccagaatg-------
Q91828_BCL2L1-01      ctggtg---gagaagtttgttagtaagaaactttcccagaatg-------
                         * *   *       * *       *        *             

B6V6J0_MCL1-01        acag----------------------------------------------
Q6GP82_BCL2L2-01      tcca----------------------------------------------
B9ZYL7_BCL2-01        atgggaagagggaaggcagcaggtctctgctgagcaccctcaagcttctg
Q90ZH2_BCL2L1-01      --------------------------------------------------
Q2TAP5_BCL2L1-01      --------------------------------------------------
Q91828_BCL2L1-01      --------------------------------------------------
                                                                        

B6V6J0_MCL1-01        --------------------gccgcagctgaatggcttg-----------
Q6GP82_BCL2L2-01      --------------------------------gagcctg-----------
B9ZYL7_BCL2-01        ctgctattagtaattattctgatgatggagaaatgcctgctgcttccgca
Q90ZH2_BCL2L1-01      --------------------------------aagcctg-----------
Q2TAP5_BCL2L1-01      --------------------------------aagcctg-----------
Q91828_BCL2L1-01      --------------------------------aagcctg-----------
                                                        ** **           

B6V6J0_MCL1-01        --------------------------------------------------
Q6GP82_BCL2L2-01      --------------------------------------------------
B9ZYL7_BCL2-01        gattcacgtggaccacctcagtcttcactcgcatctgctgcttcctcaga
Q90ZH2_BCL2L1-01      --------------------------------------------------
Q2TAP5_BCL2L1-01      --------------------------------------------------
Q91828_BCL2L1-01      --------------------------------------------------
                                                                        

B6V6J0_MCL1-01        ------------------ggctttaacaa------cggggggtcgctgcc
Q6GP82_BCL2L2-01      -----------cagga------ccagc-----------------------
B9ZYL7_BCL2-01        tgaggaaaccccaagtaatactccaataacctttgtgggcaatgcacctg
Q90ZH2_BCL2L1-01      -----------caggaagttctccaataa---------------------
Q2TAP5_BCL2L1-01      -----------caggaagttctccaataa---------------------
Q91828_BCL2L1-01      -----------caggaagttctccaataa---------------------
                                              *                         

B6V6J0_MCL1-01        ttgttcccaggaggatga-------------attagatgaggatatggat
Q6GP82_BCL2L2-01      -------------------------------atcctgtgc----------
B9ZYL7_BCL2-01        ctgttcccaggaggtctgcatctgctgtttcacccttagctgaattgaat
Q90ZH2_BCL2L1-01      ---tcccca----------------------acccaatgccatatctaat
Q2TAP5_BCL2L1-01      ---tcccca----------------------acccaatgccatatctaat
Q91828_BCL2L1-01      ---t-ccca----------------------acccaatgccatatctaat
                                                     *      *           

B6V6J0_MCL1-01        aacggatcccagggttccacgtctcccccggacagccccgtgtgccctaa
Q6GP82_BCL2L2-01      --------------------tttgcattcagcta---t---gcgtgctgc
B9ZYL7_BCL2-01        gtcgaaccaagagatcttaatgttaatccagatg---ccagtcgtgctgc
Q90ZH2_BCL2L1-01      g--gaa-c------------ttctacttcaga---------gcgccccgg
Q2TAP5_BCL2L1-01      g--gaa-c------------ttctacttcaga---------gcgccccgg
Q91828_BCL2L1-01      g--gaacc------------ttctacttcaga---------gcgccccgg
                                                  * *            *  *   

B6V6J0_MCL1-01        ggatggattatatatggacacccagcagctcattctcgctttctaccgcg
Q6GP82_BCL2L2-01      agggga------------------------------t-------------
B9ZYL7_BCL2-01        agatgg------------------------------tgataataatgatg
Q90ZH2_BCL2L1-01      ggaagg------------------------------ggccacgcagggca
Q2TAP5_BCL2L1-01      ggaagg------------------------------ggccacgcagggca
Q91828_BCL2L1-01      ggaagg------------------------------ggccacgcagggca
                       *  *                                             

B6V6J0_MCL1-01        tgtacagcggcgaggagagcggcgaattagaggcttcctgtctcctccaa
Q6GP82_BCL2L2-01      --------------------------------------------------
B9ZYL7_BCL2-01        ctgatggtggtgatgaag------------------------ctgttatg
Q90ZH2_BCL2L1-01      ttg-tggag--gaggaag------------------------tcctt---
Q2TAP5_BCL2L1-01      ttg-tggag--gaggaag------------------------tcctt---
Q91828_BCL2L1-01      ttg-tggag--gaggaag------------------------tcctt---
                                                                        

B6V6J0_MCL1-01        catggcgtccaccacaaagccctggaaaccctgctgagggtcgggggaga
Q6GP82_BCL2L2-01      -------------------------------------gaatttgaggagc
B9ZYL7_BCL2-01        cagccagtcccttcggcagtgctacagaccttgagtcgagctggagatga
Q90ZH2_BCL2L1-01      ---caagcccttttggaagcaacagag----------gagtttgagttga
Q2TAP5_BCL2L1-01      ---caagcccttttggaagcaacggag----------gagtttgagttga
Q91828_BCL2L1-01      ---caagcccttttggaagcaacggag----------gagtttgagttga
                                                           *     * *  * 

B6V6J0_MCL1-01        gattatagagaagcaccacatggccttca-cgggcatgctacaaaggttg
Q6GP82_BCL2L2-01      g-----------attcagacaagcattcagtgagatctccacacag---a
B9ZYL7_BCL2-01        gttctctcgcctatatcagcaagatttcag---acagatctcagggctcc
Q90ZH2_BCL2L1-01      g-----------atatcagcgtgccttcagtgacctgacctcacag---c
Q2TAP5_BCL2L1-01      g-----------atatcagcgtgccttcagtgacctgacctcacag---c
Q91828_BCL2L1-01      g-----------atatcagcgtgccttcagtgacctgacctcacag---c
                      *                     *  ****            **  *    

B6V6J0_MCL1-01        tctat----------acatagcagag--aagacttgcagaaactttctga
Q6GP82_BCL2L2-01      tccacgtgacccccggcacagcatatgcacgatttgctgaagtagcaggt
B9ZYL7_BCL2-01        tccatttaaccccatccacagttagggtgcgctttgcaacagtggtggag
Q90ZH2_BCL2L1-01      tgcacatcacccaggacacggcccagcagagcttccagcaagttatggga
Q2TAP5_BCL2L1-01      tgcacatcacccaggacacggcccagcagagcttccagcaagttatggga
Q91828_BCL2L1-01      tgcacatcacccaggacacggcccagcagagcttccagcaagttatggga
                      *  *            **  *         *  *      *         

B6V6J0_MCL1-01        ggttcccgctttggtctttaatgacggagttacaaattggggccgcattg
Q6GP82_BCL2L2-01      agcc----------tgttccaaggaggggt---gaattgggggcgtatag
B9ZYL7_BCL2-01        gagc----------tctttcatgatggggt---aaactggggaaggattg
Q90ZH2_BCL2L1-01      gagt----------tgttcagggatgggac---aaactgggggagaattg
Q2TAP5_BCL2L1-01      gagt----------tgttcagggatgggac---aaactgggggagaattg
Q91828_BCL2L1-01      gagt----------tgttcagggatgggac---aaactgggggagaattg
                                    * **    *  **       ** *****  * ** *

B6V6J0_MCL1-01        ttacggtcataagctttggcgcgtttgttgcaaagcatctaaagagctta
Q6GP82_BCL2L2-01      ttgcattttttgtttttggtgcc------gcactgtgtgctgagagtgtc
B9ZYL7_BCL2-01        ttgcttttttcgagtttggtggg------gtcatgtgcgtggagattgtt
Q90ZH2_BCL2L1-01      tggctttcttctcatttgggcgg------gccctatgtgtggagagtgca
Q2TAP5_BCL2L1-01      tggctttcttctcatttgggcgg------gccctatgtgtggagagtgca
Q91828_BCL2L1-01      tggctttcttctcatttgggcgg------gccctatgtgtggagagtgca
                      *  *  *  *    *****          *            ***     

B6V6J0_MCL1-01        aaccttgaag----------actgcatcggagttttggcagagcacttca
Q6GP82_BCL2L2-01      aacaaggagatgtcccctcttctgccacggattcaagactgga----tgg
B9ZYL7_BCL2-01        aaccgcgaaatgtctcctctggtggactccattgtgggttgga----tga
Q90ZH2_BCL2L1-01      aacaaggagatgactgatctgctacccagaattgtccagtgga----tgg
Q2TAP5_BCL2L1-01      aacaaggagatgactgatctgctacccagaattgtccagtgga----tgg
Q91828_BCL2L1-01      aacaaggagatgactgatctgctacccagaattgtccagtgga----tgg
                      ***   **              *       * *       *      *  

B6V6J0_MCL1-01        cgcagttcctaatgatgagcaaaaaagactggataatacaggaaaaggga
Q6GP82_BCL2L2-01      tgacatatctggagacaaacctgagaggctgg---attcagagcaatgga
B9ZYL7_BCL2-01        cagagtacctaaaccgtcacttacaaaattgg---atccaggaaca----
Q90ZH2_BCL2L1-01      tgaattatctagagcacacactgcagccctgg---atgcaggagaatgga
Q2TAP5_BCL2L1-01      tgaattatctagagcacacactgcagccctgg---atgcaggagaatgga
Q91828_BCL2L1-01      tgaattatctagagcacacactgcagccctgg---atgcaggagaatgga
                           *  **                   ***   ** ***    *    

B6V6J0_MCL1-01        ---tgggatggctttgtggacttttttcacatagaagatt----------
Q6GP82_BCL2L2-01      ggctggaatggatttctaactctat---atggggatggtgcc--------
B9ZYL7_BCL2-01        -----ggatgcatttgtggagctgt---ac--------------------
Q90ZH2_BCL2L1-01      ggctgggaagcttttgttggcctgt---atggaaagaatgccgcagccca
Q2TAP5_BCL2L1-01      ggctgggaagcttttgtcggcctgt---atggaaagaatgccgcagccca
Q91828_BCL2L1-01      ggctgggaagcttttgtcggcctgt---atggaaagaatgccgcagccca
                           * * *  *** *     * *   *                     

B6V6J0_MCL1-01        --atgaaagtggactgaaaactgttt-------------------tgatg
Q6GP82_BCL2L2-01      --atagaagaagccaggaggcaacgtgaggggaattgggcatcactgaag
B9ZYL7_BCL2-01        -aacagcaatatccagcc-accgtttgaccagagctggttatccatcaag
Q90ZH2_BCL2L1-01      gagcagagaaagccagga-acgatttg------gcaggttgct------g
Q2TAP5_BCL2L1-01      gagcagagaaagccagga-acgatttg------gcaggttgct------g
Q91828_BCL2L1-01      gagcagagaaagccagga-acgatttg------gcaggttgct------g
                                   * *    *    *                       *

B6V6J0_MCL1-01        gctttctcaagtgttgctgttcttggggccggtttggcgtacatgat---
Q6GP82_BCL2L2-01      actgtcttaactggagcggtagctctgg-gtgctttgatgacagtaggag
B9ZYL7_BCL2-01        acaatattaagccttgctgtggttggagcctgcatc-acaatagggggca
Q90ZH2_BCL2L1-01      actatagtgatgctgactggtgttttcgcattggtctgctacatgaggcg
Q2TAP5_BCL2L1-01      actatagtgattctgactggtgttttcgcattggtctgctacatgaggcg
Q91828_BCL2L1-01      actatagtgatgctgactggtgttttcgcattggtctgctacatgaggcg
                       *  *    *      * *    *   *      *     * *       

B6V6J0_MCL1-01        -------------ccgatga
Q6GP82_BCL2L2-01      ccttgtttgccagcaagtga
B9ZYL7_BCL2-01        tatccttggccaccaaataa
Q90ZH2_BCL2L1-01      -------------ccgatag
Q2TAP5_BCL2L1-01      -------------ccgatag
Q91828_BCL2L1-01      -------------ccgatag
                                   *   *  

© 1998-2023Legal notice