Dataset for CDS BCL-2-like of organism Xenopus laevis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

B6V6J0_MCL1-01        atga----------tgcaccagtcagtaattgccaag---cagcgcccct
B9ZYL7_BCL2-01        atggctcatcctagaagaggaggctatgatcaccgggacatagtg-----
Q2TAP5_BCL2L1-01      atgg--------agggcagcag----------tagagatctggtg-----
Q91828_BCL2L1-01      atgg--------agggcagcag----------tagagatctggtg-----
                      ***              *  **              *     * *     

B6V6J0_MCL1-01        cgactagtttcctcatt-----ccctgccag-------------------
B9ZYL7_BCL2-01        -gtaaaatatatccattataaactatctcagaaggggtatgcatgggaag
Q2TAP5_BCL2L1-01      -gagaagtttgttagtaagaaactttcccagaatg---------------
Q91828_BCL2L1-01      -gagaagtttgttagtaagaaactttcccagaatg---------------
                       *   * * *     *      *  *  ***                   

B6V6J0_MCL1-01        ----------------ttttactg------ctcgggcggcggctcctcag
B9ZYL7_BCL2-01        agggaaggcagcaggtctctgctgagcaccctcaagcttctgctgctatt
Q2TAP5_BCL2L1-01      --------------------------------------------------
Q91828_BCL2L1-01      --------------------------------------------------

B6V6J0_MCL1-01        agaagacattgagc----------gcgcgtggggcttctcc---------
B9ZYL7_BCL2-01        agtaattattctgatgatggagaaatgcctgctgcttccgcagattcacg
Q2TAP5_BCL2L1-01      ------------------------aagcctg-------------------
Q91828_BCL2L1-01      ------------------------aagcctg-------------------
                                                ** **                   

B6V6J0_MCL1-01        -gtgggaccccgatatggacacgcacaggccgcagctgaa----------
B9ZYL7_BCL2-01        tggaccacctcagtcttcactcgcatctgctgcttcctcagatgaggaaa
Q2TAP5_BCL2L1-01      --------------------------------------------------
Q91828_BCL2L1-01      --------------------------------------------------

B6V6J0_MCL1-01        ---tggcttgggctttaacaa------cggggggtcgctgccttgttccc
B9ZYL7_BCL2-01        ccccaagtaatactccaataacctttgtgggcaatgcacctgctgttccc
Q2TAP5_BCL2L1-01      ---caggaagttctccaataa------------------------tcccc
Q91828_BCL2L1-01      ---caggaagttctccaataa------------------------t-ccc
                                  **  ** **                        * ***

B6V6J0_MCL1-01        aggaggatga-------------attagatgaggatatggataacggatc
B9ZYL7_BCL2-01        aggaggtctgcatctgctgtttcacccttagctgaattgaatgtcgaacc
Q2TAP5_BCL2L1-01      a----------------------acccaatgccatatctaatg--gaa-c
Q91828_BCL2L1-01      a----------------------acccaatgccatatctaatg--gaacc
                      *                      *      *         **   * * *

B6V6J0_MCL1-01        ccagggttccacgtctcccccggacagccccgtgtgccctaaggatggat
B9ZYL7_BCL2-01        aagagatcttaatgttaatccagatg---ccagtcgtgctgcagatgg--
Q2TAP5_BCL2L1-01      ------------ttctacttcaga---------gcgccccggggaagg--
Q91828_BCL2L1-01      ------------ttctacttcaga---------gcgccccggggaagg--
                                     *    * **           *  *    ** **  

B6V6J0_MCL1-01        tatatatggacacccagcagctcattctcgctttctaccgcgtgtacagc
B9ZYL7_BCL2-01        -------tgataataat---------------------gatgctgatggt
Q2TAP5_BCL2L1-01      -------ggccacgcag---------------------ggcattg-tgga
Q91828_BCL2L1-01      -------ggccacgcag---------------------ggcattg-tgga
                              *  *   *                                * 

B6V6J0_MCL1-01        ggcgaggagagcggcgaattagaggcttcctgtctcctccaacatggcgt
B9ZYL7_BCL2-01        ggtgatgaag------------------------ctgttatgcagccagt
Q2TAP5_BCL2L1-01      g--gaggaag------------------------tcctt------caagc
Q91828_BCL2L1-01      g--gaggaag------------------------tcctt------caagc
                      *  ** **                             *          * 

B6V6J0_MCL1-01        ccaccacaaagccctggaaaccctgctgagggtcgggggagag-------
B9ZYL7_BCL2-01        cccttcggcagtgctacagaccttgagtcgagctggagatgagttctctc
Q2TAP5_BCL2L1-01      ccttttggaagcaacggag----------gagtttgagttgag-------
Q91828_BCL2L1-01      ccttttggaagcaacggag----------gagtttgagttgag-------
                      **       **      *           * *   * *  ***       

B6V6J0_MCL1-01        ----attatagagaagcaccac---atggccttcacgg-----gcatgct
B9ZYL7_BCL2-01        gcctatatcagcaagatttcag---acagatctcagggctcctccattta
Q2TAP5_BCL2L1-01      ----atatcagcgtgccttcagtgacctgacctcacag---ctgcacatc
Q91828_BCL2L1-01      ----atatcagcgtgccttcagtgacctgacctcacag---ctgcacatc
                          **   **        **       *   ***  *      **    

B6V6J0_MCL1-01        acaaaggttgtctatacatagcagagaaga-cttgcagaaactttctgag
B9ZYL7_BCL2-01        ac--------cccatccacagttagggtgcgctttgcaacagtggtggag
Q2TAP5_BCL2L1-01      ac--------ccaggacacggcccagcagagcttccagcaagttatggga
Q91828_BCL2L1-01      ac--------ccaggacacggcccagcagagcttccagcaagttatggga
                      **         *    **  *    *  *  ***      * *    *  

B6V6J0_MCL1-01        gttcccgctttggtctttaatgacggagttacaaattggggccgcattgt
B9ZYL7_BCL2-01        g---------agctctttcatgatgggg---taaactggggaaggattgt
Q2TAP5_BCL2L1-01      g---------agttgttcagggatggga---caaactgggggagaattgt
Q91828_BCL2L1-01      g---------agttgttcagggatggga---caaactgggggagaattgt
                      *          * * **    ** **      *** *****  * *****

B6V6J0_MCL1-01        tacggtcataagctttggcgcgtttgttgcaaagcatctaaagagcttaa
B9ZYL7_BCL2-01        tgcttttttcgagtttggtggggtcat------gtgcgtggagattgtta
Q2TAP5_BCL2L1-01      ggctttcttctcatttgggcgggccct------atgtgtggagagtgcaa
Q91828_BCL2L1-01      ggctttcttctcatttgggcgggccct------atgtgtggagagtgcaa
                        *  *  *    *****   *    *           *  ***     *

B6V6J0_MCL1-01        accttga---------------agactgcatcggagttt---tggcagag
B9ZYL7_BCL2-01        accgcgaaatgtctcctctggtggactccattgtgggttggatgacagag
Q2TAP5_BCL2L1-01      acaaggagatgactgatctgctacccagaattgtccagtggatggtgaat
Q91828_BCL2L1-01      acaaggagatgactgatctgctacccagaattgtccagtggatggtgaat
                      **   **                  *   ** *     *   **    * 

B6V6J0_MCL1-01        cacttcacgcagttcctaatgatgagcaaaaaagactggataatacagga
B9ZYL7_BCL2-01        tacctaaaccgtcactt------------acaaaattgg---atccagga
Q2TAP5_BCL2L1-01      tatctagagcacacact------------gcagccctgg---atgcagga
Q91828_BCL2L1-01      tatctagagcacacact------------gcagccctgg---atgcagga
                       *  *    *      *              *    ***   ** *****

B6V6J0_MCL1-01        aaa---gggatgggatggctttgtggactttttt----------------
B9ZYL7_BCL2-01        aca---------ggatgcatttgtggagctgtac----------------
Q2TAP5_BCL2L1-01      gaatggaggctgggaagcttttgtcggcctgtatggaaagaatgccgcag
Q91828_BCL2L1-01      gaatggaggctgggaagcttttgtcggcctgtatggaaagaatgccgcag
                        *         *** *  ***** *   * *                  

B6V6J0_MCL1-01        -----cacatagaagattatgaa--agtggactgaaaactgttttg----
B9ZYL7_BCL2-01        -----aacagcaatatccagccaccgtttgaccagagctggttatccatc
Q2TAP5_BCL2L1-01      cccagagcagagaaagccaggaacgatttg------gcaggttgct----
Q91828_BCL2L1-01      cccagagcagagaaagccaggaacgatttg------gcaggttgct----
                             **   *     *   *    * *          ***       

B6V6J0_MCL1-01        atggctttctcaagtgttgctgttcttggggccggtttggcgtacatgat
B9ZYL7_BCL2-01        aagacaatattaagccttgctgtggttggagcctgcatc-acaatagggg
Q2TAP5_BCL2L1-01      --gactatagtgattctgactggtgttttcgcattggtctgctacatgag
Q91828_BCL2L1-01      --gactatagtgatgctgactggtgttttcgcattggtctgctacatgag
                        * *  *    *   *  ***   **   **     *     * * *  

B6V6J0_MCL1-01        ----------------ccgatga
B9ZYL7_BCL2-01        gcatatccttggccaccaaataa
Q2TAP5_BCL2L1-01      gcg-------------ccgatag
Q91828_BCL2L1-01      gcg-------------ccgatag
                                      *  **  

© 1998-2020Legal notice