Dataset for CDS BCL-2-like of organism Fundulus heteroclitus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q2PJS5_BCL2L10      atgt---------------gcagaga--------gccgtcacacatc---
A0A3Q2PN77_BCL2-01      atggcgaacga---ctgcaatcgcgacatcgt--ggaaaactacatcttc
A0A3Q2NRP4_BCL2L1-      atgtcata------tagtaacagagaactggt--ggagttctacataagc
A0A3Q2QPL9_BCL2L1-      atgtctca---------aaaccgagaactggt--gctgtcctacgtcaag
A0A3Q2P7X9_MCL1-01      atgtctaaggcaccgacaagcacacaactggtaaactgtctaatttc---
A0A3Q2P7X9_MCL1-02      atgtctaaggcaccgacaagcacacaactggtaaactgtctaatttc---
                        ***                      *                *  *    

A0A3Q2PJS5_BCL2L10      -----------gctgggaggaaaatgtcctg-------------------
A0A3Q2PN77_BCL2-01      cataaact---ctccaagcgggggtac-----------------------
A0A3Q2NRP4_BCL2L1-      tacaaatt---gtcccagacaaactgtccaaactc-----------tctg
A0A3Q2QPL9_BCL2L1-      tttaaact---gtctcagaggaactatcccg---------------tcaa
A0A3Q2P7X9_MCL1-01      -tcaaaatggagtcggggacggacaaccgcactacaggccggggcttcaa
A0A3Q2P7X9_MCL1-02      -tcaaaatggagtcggggacggacaaccgcactacaggccggggcttcaa

A0A3Q2PJS5_BCL2L10      ----------tgggct----------------------------gtggaa
A0A3Q2PN77_BCL2-01      -----gcgtggaggtt----------------------------------
A0A3Q2NRP4_BCL2L1-      ctgaggtcc-gaggtt----------------------------gctgg-
A0A3Q2QPL9_BCL2L1-      cc---acat-aatgct-caacgagccgcccagcga--------cggcgg-
A0A3Q2P7X9_MCL1-01      ct---gccc-gaggttgaaatgagctcctcatcggaagatctccgctggg
A0A3Q2P7X9_MCL1-02      ct---gccc-gaggttgaaatgagctcctcatcggaagatctccgctggg
                                     * *                                  

A0A3Q2PJS5_BCL2L10      agagaccgtggctgtcgcagag------------gattacatgcgcctgc
A0A3Q2PN77_BCL2-01      ------cgacggggtccgg---------------gacgacga-------c
A0A3Q2NRP4_BCL2L1-      ------cgataggaccgagggg------------gacaagga----ctcc
A0A3Q2QPL9_BCL2L1-      ------cgccagggacgcagagtc---------tgacgaggagcag----
A0A3Q2P7X9_MCL1-01      actgttcgaaacggccgaagaacctgcgagtgatggcgaggaacggcttc
A0A3Q2P7X9_MCL1-02      actgttcgaaacggccgaagaacctgcgagtgatggcgaggaacggcttc
                              **       *                  *   *           

A0A3Q2PJS5_BCL2L10      gctgc----------tctagcc--------------------------ca
A0A3Q2PN77_BCL2-01      gctgc---------cgctaacggaggcttgggtgaccgctcgccgacttt
A0A3Q2NRP4_BCL2L1-      ccggc---------ttctagcaatggccctctggtcagcag-------ct
A0A3Q2QPL9_BCL2L1-      acggcggagacgcacgccaacgg-gaccgt--caacgggac-------ca
A0A3Q2P7X9_MCL1-01      gcggtgaaaa-gcat-ccaggag-aaccgcgacgacggctc-------cc
A0A3Q2P7X9_MCL1-02      gcggtgaaaa-gcat-ccaggag-aaccgcgacgacggctc-------cc
                         * *            * *                               

A0A3Q2PJS5_BCL2L10      cacccagcccctccacctcccagtg---------------agc-------
A0A3Q2PN77_BCL2-01      ggtccggcgctgccgcgacgcagcggcaccggggcaagacagc-gacggc
A0A3Q2NRP4_BCL2L1-      gggccggctcc------ccgtggc----------------agccttgggc
A0A3Q2QPL9_BCL2L1-      gctcgggctcc------ccgcggcggc-----ggcagc--agcagccggc
A0A3Q2P7X9_MCL1-01      tgcccagcacc------ccggagatgcaggcggacagcgaggccgccggc
A0A3Q2P7X9_MCL1-02      tgcccagcacc------ccggagatgcaggcggacagcgaggccgccggc
                           *  ** *        *   *                  **       

A0A3Q2PJS5_BCL2L10      --------ccgctgctgcca-tgaggcgcct-------------------
A0A3Q2PN77_BCL2-01      gacccccgccgcgtccgcg--ggcggctctcccagtccgacccgcacgcg
A0A3Q2NRP4_BCL2L1-      ccc-----tcatggccgcgc-ggaggctgt-------------------g
A0A3Q2QPL9_BCL2L1-      ------gtccacggcggcgatggaggcggt-------------------g
A0A3Q2P7X9_MCL1-01      tgcgggagccacgccggcca-ggaggcgct-------------------g
A0A3Q2P7X9_MCL1-02      tgcgggagccacgccggcca-ggaggcgct-------------------g
                                 *    * **    * ***                       

A0A3Q2PJS5_BCL2L10      -----------ggctc--------------------------aggacgt-
A0A3Q2PN77_BCL2-01      gacatccaccgggtcctgcgc---------------------gaggc---
A0A3Q2NRP4_BCL2L1-      aa-gtc-----ggctctgagg-----------------------gactc-
A0A3Q2QPL9_BCL2L1-      aa-ggt-----ggcgctgcgg---------------------gagac---
A0A3Q2P7X9_MCL1-01      gacagc-----gacaccacggagcttattagcggtttcctcagagacttt
A0A3Q2P7X9_MCL1-02      gacagc-----gacaccacggagcttattagcggtttcctcagagacttt
                                   *   *                            * *   

A0A3Q2PJS5_BCL2L10      ---ggagagccagcaccaggctcgtttccacgc--------cctggccca
A0A3Q2PN77_BCL2-01      ---cggcgacgagctggag---agactgtacca--------gctggactt
A0A3Q2NRP4_BCL2L1-      ---ggcggatgagtttgaa---catctcttcac--------ccaaagttt
A0A3Q2QPL9_BCL2L1-      ---ggcctgcgagttcgag---ctgcgctacgc--------ccgcgcctt
A0A3Q2P7X9_MCL1-01      actggactgtcgggcc-at---cggtggtacacgaaaaaatctctgtcta
A0A3Q2P7X9_MCL1-02      actggactgtcgggcc-at---cggtggtacacgaaaaaatctctgtcta
                            *       *    *            *                   

A0A3Q2PJS5_BCL2L10      gagc----------------------ttcctgaggcacagccaga--cgg
A0A3Q2PN77_BCL2-01      cgcg----------------gagatgtcgcagcagc-----------tgt
A0A3Q2NRP4_BCL2L1-      cagt----------------cacctctccctgcagc-----------tgg
A0A3Q2QPL9_BCL2L1-      caac----------------gacct---------gcacag-cacgc-tgc
A0A3Q2P7X9_MCL1-01      ccatgaagagggtggtggaggatctgttgtcgaagcacagatacgcttac
A0A3Q2P7X9_MCL1-02      ccatgaagagggtggtggaggatctgttgtcgaagcacagatacgcttac

A0A3Q2PJS5_BCL2L10      ac----------------------ctctgcaccagcctctggaaggtgat
A0A3Q2PN77_BCL2-01      ac-------atcaccagggacacggcgaggacgaggttcgccgaggtcgt
A0A3Q2NRP4_BCL2L1-      ac-------atcacccccgacacggcctaccacagcttcaaggccgtgct
A0A3Q2QPL9_BCL2L1-      ac-------atcacgccggccaccgcctaccagagcttcgagaacgtgat
A0A3Q2P7X9_MCL1-01      accggtatgatcaggaagctcaacctggatcagaagtcagacgacatggg
A0A3Q2P7X9_MCL1-02      accggtatgatcaggaagctcaacctggatcagaagtcagacgacatggg
                        **                               *            *   

A0A3Q2PJS5_BCL2L10      ggacgaga------------------tggtgggggacggacactttaact
A0A3Q2PN77_BCL2-01      ggacgagc------------------tgttccgggacgg---cgtgaact
A0A3Q2NRP4_BCL2L1-      ggacgagt------------------tgttcaaggacgg---ggtcaact
A0A3Q2QPL9_BCL2L1-      gaacgagg------------------tgttccgggacgg---cgtcaact
A0A3Q2P7X9_MCL1-01      gttcgtgacatcggttgcggtcagccttttctcggacggaaccaccaact
A0A3Q2P7X9_MCL1-02      gttcgtgacatcggttgcggtcagccttttctcggacggaaccaccaact
                        *  ** *                   *  *   ******       ****

A0A3Q2PJS5_BCL2L10      ggggacgggttgtatctctcttcaccttcgccggcgtgctggccagacag
A0A3Q2PN77_BCL2-01      ggggtcggattatcgctttcttcgagttcggcggcacggtgtgcgtggag
A0A3Q2NRP4_BCL2L1-      gggggcgcgtggtggggctgtttgccttcggcggggttctgtgtgtggac
A0A3Q2QPL9_BCL2L1-      ggggccgcatcgtggggctgttcgcgttcggcggcgcgctctgcgtggag
A0A3Q2P7X9_MCL1-01      ggggtcgtatcgccagcctggtggccttcggggcggtgctgtgc---cag
A0A3Q2P7X9_MCL1-02      ggggtcgtatcgccagcctggtggccttcggggcggtgctgtgc---cag
                        **** **  *        *  *    ****  *      *        * 

A0A3Q2PJS5_BCL2L10      ctgcaggagcagcagggcaggagcccggggccggaccccgggaggcagca
A0A3Q2PN77_BCL2-01      tgcgcgtccaaggagggc---------atgtca---------tcgcag--
A0A3Q2NRP4_BCL2L1-      tgcgtccagaag-aacat---------gagc-----------gagctg--
A0A3Q2QPL9_BCL2L1-      tgcgtggagaag-gagat---------gagtcc-----------cctg--
A0A3Q2P7X9_MCL1-01      cacctgaaggagagcggc---------cggtctcactgcgtggacctg--
A0A3Q2P7X9_MCL1-02      cacctgaaggagagcggc---------cggtctcactgcgtggacctg--
                                  **                 *               * *  

A0A3Q2PJS5_BCL2L10      ggagcccgtgagctgcagggagctggcggagaccatcgctgattacctgg
A0A3Q2PN77_BCL2-01      -------gtggacaaca------tcgcggagtggatgacggaatatttga
A0A3Q2NRP4_BCL2L1-      -------gtgccccgca------tcgcagactggatgaccatttacctgg
A0A3Q2QPL9_BCL2L1-      -------gtgggccgca------tcgtggagtggatgaccgtctacctgg
A0A3Q2P7X9_MCL1-01      -------gtgagccg---------------ggagatctccacatacct--
A0A3Q2P7X9_MCL1-02      -------gtgagccg---------------ggagatctccacatacct--
                               ***  *                     **  *    **  *  

A0A3Q2PJS5_BCL2L10      agaagcacaaaaaggactggctacag--gaaaacgacgg----atgggac
A0A3Q2PN77_BCL2-01      atggacctcttggcagctggatacag--gataacggggg----atgggat
A0A3Q2NRP4_BCL2L1-      atgagcagctcgacccctgggtccgc--agccagggggg----atgggaa
A0A3Q2QPL9_BCL2L1-      acgagcagatcgacccctggatccag--agccagggagg----atgggag
A0A3Q2P7X9_MCL1-01      ----gctgaccaaccagcgggactggctagccaagaacaactcatgggac
A0A3Q2P7X9_MCL1-02      ----gctgaccaaccagcgggactggctagccaagaacaactcatgggac
                             *            **            * *        ****** 

A0A3Q2PJS5_BCL2L10      gggttc-tgtaattac--------------gcccacggtgccagaggagc
A0A3Q2PN77_BCL2-01      gccttcgtggaactgtacgacagacaaaaggagtccatcttcagctgcta
A0A3Q2NRP4_BCL2L1-      tgctttgctaagctgtac---ggcca----ggacgccgccgcagcgg---
A0A3Q2QPL9_BCL2L1-      cgctttgctgaaatcttt------gg----gggcaacgcagcggcggaga
A0A3Q2P7X9_MCL1-01      ggctttgtggagttctttaaagtaga----ggacacagagtcgacggtga
A0A3Q2P7X9_MCL1-02      ggctttgtggagttctttaaagtaga----ggacacagagtcgacggtga
                           **     *  *                *          *    *   

A0A3Q2PJS5_BCL2L10      gagtcaggactcctccatgaagac-----ggcgctggttgctgtagccgg
A0A3Q2PN77_BCL2-01      c---tggccgtccatcaagactgtcttcggc--ctggctgc-gctg--gg
A0A3Q2NRP4_BCL2L1-      g---ccggaggt--ttcaggagacgttgaacaaatggctgctagtc--gg
A0A3Q2QPL9_BCL2L1-      g---cagaaggt--ctcaggagagcttcaagaactggctgctgctg--gg
A0A3Q2P7X9_MCL1-01      g---gaacacgc--tcatggcgttcgttggg--------gtcgctg--gg
A0A3Q2P7X9_MCL1-02      g---gaacacgc--tcatggcgttcgttggg--------gtcgctg--gg
                                          *                    *        **

A0A3Q2PJS5_BCL2L10      agtggg---------------catcgccgg--------------------
A0A3Q2PN77_BCL2-01      ggcgg---------ccagcatcaccatcgg--------------------
A0A3Q2NRP4_BCL2L1-      cgcggctctgctaaccggatttctgctcgt--------------------
A0A3Q2QPL9_BCL2L1-      gatgagcgtggtgacggccttcatagccgg--------------------
A0A3Q2P7X9_MCL1-01      attggg-gcaggattggcctttcttatcagaaatagtatcaaaatcagct
A0A3Q2P7X9_MCL1-02      attggg-gcaggattggcctttcttatcag--------------------
                           *                       *                      

A0A3Q2PJS5_BCL2L10      ------------------------------------gctcaccttcctcc
A0A3Q2PN77_BCL2-01      ------------------------------------ggcgtaccttgcac
A0A3Q2NRP4_BCL2L1-      ------------------------------------cgtgctcttcgcca
A0A3Q2QPL9_BCL2L1-      ------------------------------------ctccatcttcgtcc
A0A3Q2P7X9_MCL1-01      ttattggacaagattgttcctgggcattcacatctcctccgacctttcct
A0A3Q2P7X9_MCL1-02      --------------------------------------------------

A0A3Q2PJS5_BCL2L10      tggtgcgctag---
A0A3Q2PN77_BCL2-01      agaa------gtga
A0A3Q2NRP4_BCL2L1-      agaaacg---atga
A0A3Q2QPL9_BCL2L1-      agaaacgcctgtga
A0A3Q2P7X9_MCL1-01      gga-----ctgtga
A0A3Q2P7X9_MCL1-02      ----------gtga

© 1998-2022Legal notice