Dataset for CDS BAK1 of organism Crassostrea gigas

[Download (right click)] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A8W8J5M6_BAK1-02      --------------------------------------------------
A0A8W8J5M6_BAK1-08      ---------------atggcttactgggacggtggttcggggacacgggg
A0A8W8J5M6_BAK1-01      ggtgatcttggacagatggcttactgggacggtggttcggggacacgggg
A0A8W8J5M6_BAK1-04      ggtgatcttggacagatggcttactgggacggtggttcggggacacgggg
A0A8W8J5M6_BAK1-07      ggtgatcttggacagatggcttactgggacggtggttcggggacacgggg
                                                                          

A0A8W8J5M6_BAK1-02      ----------------------------------cagatcccctctccct
A0A8W8J5M6_BAK1-08      agggggaagggtccctccttcctcagacgtccgccagatcccctctccct
A0A8W8J5M6_BAK1-01      agggggaagggtccctccttcctcagacgtccgccagatcccctctccct
A0A8W8J5M6_BAK1-04      agggggaagggtccctccttcctcagacgtccgccagatcccctctccct
A0A8W8J5M6_BAK1-07      agggggaagggtccctccttcctcagacgtccgccagatcccctctccct
                                                          ****************

A0A8W8J5M6_BAK1-02      cagaacaaatgacgcctgacactgaggagaatgtcattgatgaggcggag
A0A8W8J5M6_BAK1-08      cagaacaaatgacgcctgacactgaggagaatgtcattgatgaggcggag
A0A8W8J5M6_BAK1-01      cagaacaaatgacgcctgacactgaggagaatgtcattgatgaggcggag
A0A8W8J5M6_BAK1-04      cagaacaaatgacgcctgacactgaggagaatgtcattgatgaggcggag
A0A8W8J5M6_BAK1-07      cagaacaaatgacgcctgacactgaggagaatgtcattgatgaggcggag
                        **************************************************

A0A8W8J5M6_BAK1-02      gatgtgatcaggaactttatatttgagagttatcagcatcagcttgttga
A0A8W8J5M6_BAK1-08      gatgtgatcaggaactttatatttgagagttatcagcatcagcttgttga
A0A8W8J5M6_BAK1-01      gatgtgatcaggaactttatatttgagagttatcagcatcagcttgttga
A0A8W8J5M6_BAK1-04      gatgtgatcaggaactttatatttgagagttatcagcatcagcttgttga
A0A8W8J5M6_BAK1-07      gatgtgatcaggaactttatatttgagagttatcagcatcagcttgttga
                        **************************************************

A0A8W8J5M6_BAK1-02      ggaggtggatactctggattccaccacccctcaggtcccggagctgtgtg
A0A8W8J5M6_BAK1-08      ggaggtggatactctggattccaccacccctcaggtcccggagctgtgtg
A0A8W8J5M6_BAK1-01      ggaggtggatactctggattccaccacccctcaggtcccggagctgtgtg
A0A8W8J5M6_BAK1-04      ggaggtggatactctggattccaccacccctcaggtcccggagctgtgtg
A0A8W8J5M6_BAK1-07      ggaggtggatactctggattccaccacccctcaggtcccggagctgtgtg
                        **************************************************

A0A8W8J5M6_BAK1-02      ccttcacgtccgatcccatgagtcgagcttcacaagttggtcggcagttg
A0A8W8J5M6_BAK1-08      ccttcacgtccgatcccatgagtcgagcttcacaagttggtcggcagttg
A0A8W8J5M6_BAK1-01      ccttcacgtccgatcccatgagtcgagcttcacaagttggtcggcagttg
A0A8W8J5M6_BAK1-04      ccttcacgtccgatcccatgagtcgagcttcacaagttggtcggcagttg
A0A8W8J5M6_BAK1-07      ccttcacgtccgatcccatgagtcgagcttcacaagttggtcggcagttg
                        **************************************************

A0A8W8J5M6_BAK1-02      gctaggattggagatgacataaataggcgatatgccgatgaattcaaaga
A0A8W8J5M6_BAK1-08      gctaggattggagatgacataaataggcgatatgccgatgaattcaaaga
A0A8W8J5M6_BAK1-01      gctaggattggagatgacataaataggcgatatgccgatgaattcaaaga
A0A8W8J5M6_BAK1-04      gctaggattggagatgacataaataggcgatatgccgatgaattcaaaga
A0A8W8J5M6_BAK1-07      gctaggattggagatgacataaataggcgatatgccgatgaattcaaaga
                        **************************************************

A0A8W8J5M6_BAK1-02      catgattaatcagctgaatgtgaatgaagatacggcttatgaagtgttcg
A0A8W8J5M6_BAK1-08      catgattaatcagctgaatgtgaatgaagatacggcttatgaagtgttcg
A0A8W8J5M6_BAK1-01      catgattaatcagctgaatgtgaatgaagatacggcttatgaagtgttcg
A0A8W8J5M6_BAK1-04      catgattaatcagctgaatgtgaatgaagatacggcttatgaagtgttcg
A0A8W8J5M6_BAK1-07      catgattaatcagctgaatgtgaatgaagatacggcttatgaagtgttcg
                        **************************************************

A0A8W8J5M6_BAK1-02      ctggagttgccaaaaagttgtttgcagatgaaataaactgggggcgggtt
A0A8W8J5M6_BAK1-08      ctggagttgccaaaaagttgtttgcagatgaaataaactgggggcgggtt
A0A8W8J5M6_BAK1-01      ctggagttgccaaaaagttgtttgcagatgaaataaactgggggcgggtt
A0A8W8J5M6_BAK1-04      ctggagttgccaaaaagttgtttgcagatgaaataaactgggggcgggtt
A0A8W8J5M6_BAK1-07      ctggagttgccaaaaagttgtttgcagatgaaataaactgggggcgggtt
                        **************************************************

A0A8W8J5M6_BAK1-02      gcagctttaatgtgcctagcgtaccgtatcaccatgactgttgtcaagga
A0A8W8J5M6_BAK1-08      gcagctttaatgtgcctagcgtaccgtatcaccatgactgttgtcaagga
A0A8W8J5M6_BAK1-01      gcagctttaatgtgcctagcgtaccgtatcaccatgactgttgtcaagga
A0A8W8J5M6_BAK1-04      gcagctttaatgtgcctagcgtaccgtatcaccatgactgttgtcaagga
A0A8W8J5M6_BAK1-07      gcagctttaatgtgcctagcgtaccgtatcaccatgactgttgtcaagga
                        **************************************************

A0A8W8J5M6_BAK1-02      gaaagccaaaaagtttgctcagttcatgaaggtcattgtcagtcatgttg
A0A8W8J5M6_BAK1-08      gaaagccaaaaagtttgctcagttcatgaaggtcattgtcagtcatgttg
A0A8W8J5M6_BAK1-01      gaaagccaaaaagtttgctcagttcatgaaggtcattgtcagtcatgttg
A0A8W8J5M6_BAK1-04      gaaagccaaaaagtttgctcagttcatgaaggtcattgtcagtcatgttg
A0A8W8J5M6_BAK1-07      gaaagccaaaaagtttgctcagttcatgaaggtcattgtcagtcatgttg
                        **************************************************

A0A8W8J5M6_BAK1-02      ttcgattcatcaaagagaaaatagccgggtggattgcaagtcaaggggga
A0A8W8J5M6_BAK1-08      ttcgattcatcaaagagaaaatagccgggtggattgcaagtcaaggggga
A0A8W8J5M6_BAK1-01      ttcgattcatcaaagagaaaatagccgggtggattgcaagtcaaggggga
A0A8W8J5M6_BAK1-04      ttcgattcatcaaagagaaaatagccgggtggattgcaagtcaaggggga
A0A8W8J5M6_BAK1-07      ttcgattcatcaaagagaaaatagccgggtggattgcaagtcaaggggga
                        **************************************************

A0A8W8J5M6_BAK1-02      tggagtgcagccctccagtattccccctccatgagttttacctccctctc
A0A8W8J5M6_BAK1-08      tggagtgcagccctccagtattccccctccatgagttttacctccctctc
A0A8W8J5M6_BAK1-01      tggagtgcagccctccagtattccccctccatgagttttacctccctctc
A0A8W8J5M6_BAK1-04      tggagtgcagccctccagtattccccctccatgagttttacctccctctc
A0A8W8J5M6_BAK1-07      tggagtgcagccctccagtattccccctccatgagttttacctccctctc
                        **************************************************

A0A8W8J5M6_BAK1-02      cattgttgtggggtcgtgcgtggtggccattgctgctgtgttctacttca
A0A8W8J5M6_BAK1-08      cattgttgtggggtcgtgcgtggtggccattgctgctgtgttctacttca
A0A8W8J5M6_BAK1-01      cattgttgtggggtcgtgcgtggtggccattgctgctgtgttctacttca
A0A8W8J5M6_BAK1-04      cattgttgtggggtcgtgcgtggtggccattgctgctgtgttctacttca
A0A8W8J5M6_BAK1-07      cattgttgtggggtcgtgcgtggtggccattgctgctgtgttctacttca
                        **************************************************

A0A8W8J5M6_BAK1-02      gcaaaaagagttga
A0A8W8J5M6_BAK1-08      gcaaaaagagttga
A0A8W8J5M6_BAK1-01      gcaaaaagagttga
A0A8W8J5M6_BAK1-04      gcaaaaagagttga
A0A8W8J5M6_BAK1-07      gcaaaaagagttga
                        **************

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice