Dataset for CDS BCL-2-like of organism Falco tinnunculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4U5U5_BCL2A1-      ---------------at---------------------------------
A0A8C4TWS5_BCL2L1-      ---------------atg-----------tccag-------------cag
A0A8C4U2H6_MCL1-01      ---------------atggtgcgggct--gcgagggctgcgaggc--cgg
A0A8C4U538_BCL2-01      cagaggaacatatttatagtccaagctcatccggggagaagaggctacga
A0A8C4U538_BCL2-02      ---------------at------ggctcatccggggagaagaggctacga
                                       **                                 

A0A8C4U5U5_BCL2A1-      -----gggaactgc-------------ggagttctattac----------
A0A8C4TWS5_BCL2L1-      taaccgggagttagtgat---------tgactttgtttcctacaagctct
A0A8C4U2H6_MCL1-01      tgcccgggggcgcctgctttgccggggggagttggggcactgcagcaccc
A0A8C4U538_BCL2-01      taaccgggagatagtgct---------gaagtacatccactataaactct
A0A8C4U538_BCL2-02      taaccgggagatagtgct---------gaagtacatccactataaactct
                             ***                     * *       *          

A0A8C4U5U5_BCL2A1-      ---------------------------------gtttattacttagctc-
A0A8C4TWS5_BCL2L1-      cgcagaag-------------------------gggtacagctggagtca
A0A8C4U2H6_MCL1-01      cgtggtgatggggtgggagggggtggcacgcctgggtctgaccgggctgg
A0A8C4U538_BCL2-01      cgcagcgg-------------------------ggatacgactgggctg-
A0A8C4U538_BCL2-02      cgcagcgg-------------------------ggatacgactgggctg-
                                                         *  *    *     *  

A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      g-------------------------------------------------
A0A8C4U2H6_MCL1-01      gaggcacaagcagggcagacacaaggcaccgagcagggccaggccggggg
A0A8C4U538_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-02      --------------------------------------------------
                                                                          

A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      --------------------------------------------------
A0A8C4U2H6_MCL1-01      aggcggcgtgtgcagcggggccgggggtgcccggtgtggggccgcaggag
A0A8C4U538_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-02      --------------------------------------------------
                                                                          

A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      --ctggagga----------------------------------------
A0A8C4U2H6_MCL1-01      gcccggcggggtgacgcctctccgcgggggcggcgggggctctttcgccc
A0A8C4U538_BCL2-01      --ccggcgag----------------------------------------
A0A8C4U538_BCL2-02      --ccggcgag----------------------------------------
                                                                          

A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      -----------------------------ggaggatgagaac--------
A0A8C4U2H6_MCL1-01      tttttcaccccaaaaagccccggcctggcgaggcgtgacacccacccccc
A0A8C4U538_BCL2-01      -------------------------------gacagggcacccctgcctc
A0A8C4U538_BCL2-02      -------------------------------gacagggcacccctgcctc
                                                                          

A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      --------------------------------------------------
A0A8C4U2H6_MCL1-01      ccgggccgtgccggaagcggggccggaaacgcggccggaagtggaccggc
A0A8C4U538_BCL2-01      c-------------------------------------------------
A0A8C4U538_BCL2-02      c-------------------------------------------------
                                                                          

A0A8C4U5U5_BCL2A1-      -aagattatct---------------------------------------
A0A8C4TWS5_BCL2L1-      -aggactgactttgca----------------------------------
A0A8C4U2H6_MCL1-01      gcggcctcgctccgcccccgtcgtgccccgcgtcgcgtcccgtcacgtca
A0A8C4U538_BCL2-01      -aggtctctctcctcc----------------------------------
A0A8C4U538_BCL2-02      -aggtctctctcctcc----------------------------------
                           *  *  **                                       

A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      --------------------------------------------------
A0A8C4U2H6_MCL1-01      ccgccgccatataagcggcagcgacgctcaccgccgcgcagctcgccgtt
A0A8C4U538_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-02      --------------------------------------------------
                                                                          

A0A8C4U5U5_BCL2A1-      -----gcagtatgtgcttcaagaatca-----------------------
A0A8C4TWS5_BCL2L1-      -----gcagaggaggccgagatggacg-----------------------
A0A8C4U2H6_MCL1-01      cgtgcgcagtggccgccatgttcgctgtgaagcggaacgccgtcattagc
A0A8C4U538_BCL2-01      ----tgctgctgctgctgcggttgctg-----------------------
A0A8C4U538_BCL2-02      ----tgctgctgctgctgcggttgctg-----------------------
                             ** *     **                                  

A0A8C4U5U5_BCL2A1-      ---------------------------------------------catct
A0A8C4TWS5_BCL2L1-      --------------------------------------------gcgtcc
A0A8C4U2H6_MCL1-01      ttcaacctctactgcggtggc--ggcctggccctggcgcctgcctcgccc
A0A8C4U538_BCL2-01      --------ctgctgctgctgctgggacttcctctga--------tcacac
A0A8C4U538_BCL2-02      --------ctgctgctgctgctgggacttcctctga--------tcacac
                                                                     *    

A0A8C4U5U5_BCL2A1-      tggaccag----------------------------ccca----------
A0A8C4TWS5_BCL2L1-      tcaatggg--------------agcccctcttggcacccgc--------c
A0A8C4U2H6_MCL1-01      ggggggggcccgacgccgccgccgcccgccgtcgtccccgccacggccgc
A0A8C4U538_BCL2-01      tgggctgg--------tgtctccgcaccccgagccccccggctcggctgc
A0A8C4U538_BCL2-02      tgggctgg--------tgtctccgcaccccgagccccccggctcggctgc
                               *                            ***           

A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      cgcc----------------------------------------------
A0A8C4U2H6_MCL1-01      cgccgccgccgaggtgccctgggccgccgccagtcgccccgaggtacccc
A0A8C4U538_BCL2-01      tgct----------------------------------------------
A0A8C4U538_BCL2-02      tgct----------------------------------------------
                                                                          

A0A8C4U5U5_BCL2A1-      ----------------aaccagg-----------gttg------------
A0A8C4TWS5_BCL2L1-      ----------------agccacgtagtgaatggagctgccgtgcaccgga
A0A8C4U2H6_MCL1-01      gcacgctgattggccaggccgcagccccccgctcgctgattggctgcggc
A0A8C4U538_BCL2-01      ----------------agccacgtgcccccg---gctgaggggctgc---
A0A8C4U538_BCL2-02      ----------------agccacgtgcccccg---gctgaggggctgc---
                                          **              * **            

A0A8C4U5U5_BCL2A1-      -----ctcatgtcttgcgaaatattgca-------------------tct
A0A8C4TWS5_BCL2L1-      gcagcctcgaagtccatgaaattgttcaagcagccgatgtgaggcag---
A0A8C4U2H6_MCL1-01      gcggccccccgcgccgcg---ctgcccc-----ccggcgggcggccggcc
A0A8C4U538_BCL2-01      ---gccccgcaccccagg---ttgtcca-----cc-------------tc
A0A8C4U538_BCL2-02      ---gccccgcaccccagg---ttgtcca-----cc-------------tc
                             * *         *        *                       

A0A8C4U5U5_BCL2A1-      tcgctgc-------------------------------------------
A0A8C4TWS5_BCL2L1-      gcgctga-------------------------------------------
A0A8C4U2H6_MCL1-01      gcgctgtggagccccgaggaggagctggacggctgcgagcccgagcccga
A0A8C4U538_BCL2-01      accctgc-------------------------------------------
A0A8C4U538_BCL2-02      accctgc-------------------------------------------
                         * ***                                            

A0A8C4U5U5_BCL2A1-      --aagatcaaaccgaggag-------------------------------
A0A8C4TWS5_BCL2L1-      -----gggaggcaggggat-------------------------------
A0A8C4U2H6_MCL1-01      gcgcggcccggcgggggactcgctgcccggcccgcccgacgggctgcggc
A0A8C4U538_BCL2-01      -----gccaggcgggggac-------------------------------
A0A8C4U538_BCL2-02      -----gccaggcgggggac-------------------------------
                                   * * ***                                

A0A8C4U5U5_BCL2A1-      -------------gctctcaaaccatt-----------------------
A0A8C4TWS5_BCL2L1-      -----------gagtttgagttgaggtaccggcagg--------------
A0A8C4U2H6_MCL1-01      aggactcgctggagctcatcagccgctacctgcgggaggcggcgggcgag
A0A8C4U538_BCL2-01      -----------gagttctcccgccgctaccagaggga-------------
A0A8C4U538_BCL2-02      -----------gagttctcccgccgctaccagaggga-------------
                                     * *          *                       

A0A8C4U5U5_BCL2A1-      ---------------------cttagacaag----attgatattacctct
A0A8C4TWS5_BCL2L1-      ---------------------ctttcagcga----------cctcacttc
A0A8C4U2H6_MCL1-01      tccgagcccggcgccaagaagcttttcccggggctgctgggcgggcctgg
A0A8C4U538_BCL2-01      ---------------------ctttgcccaa-----------atgtctgg
A0A8C4U538_BCL2-02      ---------------------ctttgcccaa-----------atgtctgg
                                             ***                      **  

A0A8C4U5U5_BCL2A1-      gtagct--------------------------------------------
A0A8C4TWS5_BCL2L1-      ccagct----------------------ccacatcacccccggc------
A0A8C4U2H6_MCL1-01      ccggcccggcgatgccgtgatggagaaggcgctggagacgctgcggagag
A0A8C4U538_BCL2-01      ccagtt----------------------gcacctgacgcccttc------
A0A8C4U538_BCL2-02      ccagtt----------------------gcacctgacgcccttc------
                           *                                              

A0A8C4U5U5_BCL2A1-      ------gttg---------------------------ccaagagaatttt
A0A8C4TWS5_BCL2L1-      ------acag-----------------------------------cgtat
A0A8C4U2H6_MCL1-01      tcggcaacggagtgatgcagaagcacgagctcaccttccagggaatgctt
A0A8C4U538_BCL2-01      ------acgg---------------------------ccaggggccgctt
A0A8C4U538_BCL2-02      ------acgg---------------------------ccaggggccgctt
                                 *                                       *

A0A8C4U5U5_BCL2A1-      caatggtgtc---------------------------------atggaag
A0A8C4TWS5_BCL2L1-      cagagctttg------------------------agcaggta-gtgaatg
A0A8C4U2H6_MCL1-01      cagaagttggacatccagaaagaggaagatctgcagtcagtgtgtgaagt
A0A8C4U538_BCL2-01      cg-----tgg---------------------------cggtg-gtggagg
A0A8C4U538_BCL2-02      cg-----tgg---------------------------cggtg-gtggagg
                        *                                           ** *  

A0A8C4U5U5_BCL2A1-      aaa--------aatttgctgatggaaatactaactggggacgaattatga
A0A8C4TWS5_BCL2L1-      aac--------tcttccgcgatggagt---gaactggggtcgcatcgtgg
A0A8C4U2H6_MCL1-01      ggctgcccatgtgttcagtgatggagtaacaaactggggtcgagtggtga
A0A8C4U538_BCL2-01      agc--------tcttccgagatggggt---taactggggcaggattgtgg
A0A8C4U538_BCL2-02      agc--------tcttccgagatggggt---taactggggcaggattgtgg
                                     **    *****       ********  *  *  ** 

A0A8C4U5U5_BCL2A1-      ccatatttacgtttggag--------gtcttctcactaagaagcttcaag
A0A8C4TWS5_BCL2L1-      ctttcttctccttcggagga------gccttgtgtgtggagagcgttga-
A0A8C4U2H6_MCL1-01      cgctaatctcatttggtgcctttgttgcaaaacacctgaaaagcataaa-
A0A8C4U538_BCL2-01      ccttcttcgagttcggcggc------gtgatgtgcgtggagagtgtcaa-
A0A8C4U538_BCL2-02      ccttcttcgagttcggcggc------gtgatgtgcgtggagagtgtcaa-
                        *  *  *    ** ** *        *         *    **  *  * 

A0A8C4U5U5_BCL2A1-      agcatggagt------tcagctcactggagaggagaaggagcagatttct
A0A8C4TWS5_BCL2L1-      --caaggagatgcgggt------attggtgggacgc--------attgta
A0A8C4U2H6_MCL1-01      --ccaggagaagtgcatcagctcgctggcaaggatc--------atcac-
A0A8C4U538_BCL2-01      --cagggaga--tgtctcccctcgtagacag----c--------atcgct
A0A8C4U538_BCL2-02      --cagggaga--tgtctcccctcgtagacag----c--------atcgct
                          *  ****       *         *                 **    

A0A8C4U5U5_BCL2A1-      tatttcatcacagagt---acataataaacaacaaagctgaatggataga
A0A8C4TWS5_BCL2L1-      gcttggatgaccacgt---acttgaccgaccacctagatccctggatcca
A0A8C4U2H6_MCL1-01      ----ggatgctctcgtctcatctaa----------gcgcgagtggcttat
A0A8C4U538_BCL2-01      gcctggatgaccgagt---acctgaaccggcacctgcacaactggatcca
A0A8C4U538_BCL2-02      gcctggatgaccgagt---acctgaaccggcacctgcacaactggatcca
                              **      **   *  * *                 *** *   

A0A8C4U5U5_BCL2A1-      tgcgaacggtggctgggaaaatggcttcctaacgaagtttgaaag-----
A0A8C4TWS5_BCL2L1-      ggagaatggcggatggg---agcggtttgtggacctctacgggaacaatg
A0A8C4U2H6_MCL1-01      gagtcagggaggctggg---atggctttgttgacttctttcgagt-----
A0A8C4U538_BCL2-01      ggacaacggaggctggg---------------------------------
A0A8C4U538_BCL2-02      ggacaacggaggctggg---atgccttcgtggagttgtatggcaacagta
                             * ** ** ****                                 

A0A8C4U5U5_BCL2A1-      --------------------------aagatcactactatctttctccaa
A0A8C4TWS5_BCL2L1-      ctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctg
A0A8C4U2H6_MCL1-01      t-------------------------gaggacctaga-aggcagcatcag
A0A8C4U538_BCL2-01      t-------------------------acgtcccccgattgctcgttcc--
A0A8C4U538_BCL2-02      t-------------------------gaggcctttgtttgatttctcctg
                                                    *  *               *  

A0A8C4U5U5_BCL2A1-      aattac---agccatgttcatagctgttttt---------agcttgttca
A0A8C4TWS5_BCL2L1-      a----ccggggcgacggtggcaggagtgcttctgctgggatccctgctga
A0A8C4U2H6_MCL1-01      aaacatactgatggtgtttgcaggtgtggctggactg-ggagcaagcttg
A0A8C4U538_BCL2-01      ---ctctc-----------------ctggctctggtgcacagccagtggg
A0A8C4U538_BCL2-02      gatctctctgaagactatcctgagtctggttctggtg-ggagcttgcatc
                                                  *   *           *  *    

A0A8C4U5U5_BCL2A1-      ga------------------------------------------------
A0A8C4TWS5_BCL2L1-      gc------------------------------------------------
A0A8C4U2H6_MCL1-01      gcctacatgatccgagctaatgatgcaaaaaggaggatttttgaatgtgg
A0A8C4U538_BCL2-01      gc--------tccggg----------------------------------
A0A8C4U538_BCL2-02      ac--------tcttggc---------------------------------
                                                                          

A0A8C4U5U5_BCL2A1-      -----------------------------------------gagtactac
A0A8C4TWS5_BCL2L1-      ----------------cgc----------------------aagtga---
A0A8C4U2H6_MCL1-01      tagaactgcttatgggtgcactgtacttcattcctcatgtgaagtagcat
A0A8C4U538_BCL2-01      -----------gtgggc-------------------------agta----
A0A8C4U538_BCL2-02      ----gcttatcttggacat----------------------aagtag---
                                                                  ***     

A0A8C4U5U5_BCL2A1-      taa--------------------------
A0A8C4TWS5_BCL2L1-      -----------------------------
A0A8C4U2H6_MCL1-01      ttttgtggcgaagccttctcctgccttga
A0A8C4U538_BCL2-01      -----------------------------
A0A8C4U538_BCL2-02      -----------------------------
                                                     

© 1998-2023Legal notice