Dataset for CDS BCL-2-like of organism Falco tinnunculus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A8C4TWS5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Falco tinnunculus GN=BCL2L1 (length=693 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcgcagaaggggtacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagcagaggaggccgagatggacggcgtcctcaatgggagcccctctt
ggcacccgcccgccagccacgtagtgaatggagctgccgtgcaccggagcagcctcgaagtccatgaaattgttcaagca
gccgatgtgaggcaggcgctgagggaggcaggggatgagtttgagttgaggtaccggcaggctttcagcgacctcacttc
ccagctccacatcacccccggcacagcgtatcagagctttgagcaggtagtgaatgaactcttccgcgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcattgtagcttggatgaccacgtacttgaccgaccacctagatccctggatccaggagaatggcggatgggagcg
gtttgtggacctctacgggaacaatgctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggcaggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C4U2H6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Falco tinnunculus GN=MCL-1 (length=1539 residues).
atggtgcgggctgcgagggctgcgaggccggtgcccgggggcgcctgctttgccggggggagttggggcactgcagcacc
ccgtggtgatggggtgggagggggtggcacgcctgggtctgaccgggctgggaggcacaagcagggcagacacaaggcac
cgagcagggccaggccgggggaggcggcgtgtgcagcggggccgggggtgcccggtgtggggccgcaggaggcccggcgg
ggtgacgcctctccgcgggggcggcgggggctctttcgccctttttcaccccaaaaagccccggcctggcgaggcgtgac
acccaccccccccgggccgtgccggaagcggggccggaaacgcggccggaagtggaccggcgcggcctcgctccgccccc
gtcgtgccccgcgtcgcgtcccgtcacgtcaccgccgccatataagcggcagcgacgctcaccgccgcgcagctcgccgt
tcgtgcgcagtggccgccatgttcgctgtgaagcggaacgccgtcattagcttcaacctctactgcggtggcggcctggc
cctggcgcctgcctcgcccggggggggcccgacgccgccgccgcccgccgtcgtccccgccacggccgccgccgccgccg
aggtgccctgggccgccgccagtcgccccgaggtaccccgcacgctgattggccaggccgcagccccccgctcgctgatt
ggctgcggcgcggccccccgcgccgcgctgccccccggcgggcggccggccgcgctgtggagccccgaggaggagctgga
cggctgcgagcccgagcccgagcgcggcccggcgggggactcgctgcccggcccgcccgacgggctgcggcaggactcgc
tggagctcatcagccgctacctgcgggaggcggcgggcgagtccgagcccggcgccaagaagcttttcccggggctgctg
ggcgggcctggccggcccggcgatgccgtgatggagaaggcgctggagacgctgcggagagtcggcaacggagtgatgca
gaagcacgagctcaccttccagggaatgcttcagaagttggacatccagaaagaggaagatctgcagtcagtgtgtgaag
tggctgcccatgtgttcagtgatggagtaacaaactggggtcgagtggtgacgctaatctcatttggtgcctttgttgca
aaacacctgaaaagcataaaccaggagaagtgcatcagctcgctggcaaggatcatcacggatgctctcgtctcatctaa
gcgcgagtggcttatgagtcagggaggctgggatggctttgttgacttctttcgagttgaggacctagaaggcagcatca
gaaacatactgatggtgtttgcaggtgtggctggactgggagcaagcttggcctacatgatccgagctaatgatgcaaaa
aggaggatttttgaatgtggtagaactgcttatgggtgcactgtacttcattcctcatgtgaagtagcatttttgtggcg
aagccttctcctgccttga
>gnl|bcl2dbcds|A0A8C4U538_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Falco tinnunculus GN=BCL-2 (length=687 residues).
cagaggaacatatttatagtccaagctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatcca
ctataaactctcgcagcggggatacgactgggctgccggcgaggacagggcacccctgcctccaggtctctctcctcctg
ctgctgctgctgcggttgctgctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgag
ccccccggctcggctgctgctagccacgtgcccccggctgaggggctgcgccccgcaccccaggttgtccacctcaccct
gcgccaggcgggggacgagttctcccgccgctaccagagggactttgcccaaatgtctggccagttgcacctgacgccct
tcacggccaggggccgcttcgtggcggtggtggaggagctcttccgagatggggttaactggggcaggattgtggccttc
ttcgagttcggcggcgtgatgtgcgtggagagtgtcaacagggagatgtctcccctcgtagacagcatcgctgcctggat
gaccgagtacctgaaccggcacctgcacaactggatccaggacaacggaggctgggtacgtcccccgattgctcgttccc
tctcctggctctggtgcacagccagtggggctccggggtgggcagta
>gnl|bcl2dbcds|A0A8C4U538_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Falco tinnunculus GN=BCL-2 (length=729 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagcgggg
atacgactgggctgccggcgaggacagggcacccctgcctccaggtctctctcctcctgctgctgctgctgcggttgctg
ctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgct
agccacgtgcccccggctgaggggctgcgccccgcaccccaggttgtccacctcaccctgcgccaggcgggggacgagtt
ctcccgccgctaccagagggactttgcccaaatgtctggccagttgcacctgacgcccttcacggccaggggccgcttcg
tggcggtggtggaggagctcttccgagatggggttaactggggcaggattgtggccttcttcgagttcggcggcgtgatg
tgcgtggagagtgtcaacagggagatgtctcccctcgtagacagcatcgctgcctggatgaccgagtacctgaaccggca
cctgcacaactggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggcctttgtttg
atttctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatcttgga
cataagtag
>gnl|bcl2dbcds|A0A8C4U5U5_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Falco tinnunculus GN=BCL2A1 (length=525 residues).
atgggaactgcggagttctattacgtttattacttagctcaagattatctgcagtatgtgcttcaagaatcacatcttgg
accagcccaaaccagggttgctcatgtcttgcgaaatattgcatcttcgctgcaagatcaaaccgaggaggctctcaaac
cattcttagacaagattgatattacctctgtagctgttgccaagagaattttcaatggtgtcatggaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacgtttggaggtcttctcactaagaagcttcaagagcatgg
agttcagctcactggagaggagaaggagcagatttcttatttcatcacagagtacataataaacaacaaagctgaatgga
tagatgcgaacggtggctgggaaaatggcttcctaacgaagtttgaaagaagatcactactatctttctccaaaattaca
gccatgttcatagctgtttttagcttgttcagagagtactactaa
© 1998-2023Legal notice