Dataset for CDS BAK1 of Organism Cyanoderma ruficeps

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C3NN90_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Cyanoderma ruficeps GN=BAK1 (length=630 residues).
atggcctcagggaatgaggaggagcctccacgggcactggaacgccgggggagccgcagctcagaaggtcgtgtggcaga
ggaggccgagggggtgttccggagtttcgccttctaccgctaccagcaggagcgccaggagcgaggggcagagctgcggc
cggacccggagatcgagcaaatccagcaggacctgaagagcaccgagagccaggtgggcgagcgcctggccatcatcggg
gatgacatctaccggcgctacgacgtggagttctgcagcatgctgggctccctgcagctcacccccgacaacgcctacca
gcacttcaccgaaatcgcctcccggctgttcgagagtggcatcaactggggccgggtgatcgccctgctggccttcgggt
accgcatggccatgcacgtgtggcagcgcggcgtgcgcggcttcctgcgccgcatcgccggcttcctcagggacttcatg
ctgcacaaccacatcgcccgctggatcgcccagcagggaggatggagggccgtgtgggaccgtgagttctgtgtttgtgt
caagtacctgctggtggcggccgtggtgctgctgggccacctggtggtgcgacgcttcttcaccccctga
© 1998-2023Legal notice