Dataset for CDS BCL2L2 of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A5F5PML6_BCL2L2-      atggcggcggcggcggcggcggcagcagcagcgggggct----gcgggcg
A0A5F5PML6_BCL2L2-      atggcgaccccagcctcagccccagacaca-cgggctctagtggcagact
A0A5F5PML6_BCL2L2-      atggcgaccccagcctcagccccagacaca-cgggctctagtggcagact
                        ****** *  * **  * **  ***   ** ****  **    ** * * 

A0A5F5PML6_BCL2L2-      gtcggggctccgggccggggcggcggcgccat-cttgtgcccggggccgg
A0A5F5PML6_BCL2L2-      ttgtaggctataagctgaggcagaagggttatgtttgtggagctggcccc
A0A5F5PML6_BCL2L2-      ttgtaggctataagctgaggcagaagggttatgtttgtggagctggcccc
                         *   ****    ** * *** *  * *  **  *****     ****  

A0A5F5PML6_BCL2L2-      tggggaggccggggagggggccccggggggcgcaggggactacgggaacg
A0A5F5PML6_BCL2L2-      ggggagggcccagccgctgaccc-----actgcaccaagccatgcgggca
A0A5F5PML6_BCL2L2-      ggggagggcccagccgctgaccc-----actgcaccaagccatgcgggca
                         ***  ****  *  *  * ***        ***     * * * *  * 

A0A5F5PML6_BCL2L2-      gcctg----gagtctgaggaactggagcctgaggagctgct----gctgg
A0A5F5PML6_BCL2L2-      gctggagatgagtttga-gacccgcttccggcgcaccttctctgatctgg
A0A5F5PML6_BCL2L2-      gctggagatgagtttga-gacccgcttccggcgcaccttctctgatctgg
                        **  *    **** *** ** * *   ** * * * ** **     ****

A0A5F5PML6_BCL2L2-      agcccgagccg-----gagcccg-----agcccgaagaggagccgccccg
A0A5F5PML6_BCL2L2-      cggctcagctgcatgtgaccccgggctcagcccagcaacgcttcacccag
A0A5F5PML6_BCL2L2-      cggctcagctgcatgtgaccccgggctcagcccagcaacgcttcacccag
                         * *  *** *     ** ****     *****    * *   * *** *

A0A5F5PML6_BCL2L2-      gcccc------gcgcccccccgggagctccgg--------gccctg-ggc
A0A5F5PML6_BCL2L2-      gtctctgacgaactcttccaaggtggccccaactggggccgccttgtggc
A0A5F5PML6_BCL2L2-      gtctctgacgaactcttccaaggtggccccaactggggccgccttgtggc
                        * * *       * *  **  **  ** **          *** ** ***

A0A5F5PML6_BCL2L2-      c-----tggctcgggagc--ccccggcagccaggag-------gaggagg
A0A5F5PML6_BCL2L2-      cttctttgtctttggagccgcgctgtgtgctgagagtgtcaacaaggaga
A0A5F5PML6_BCL2L2-      cttctttgtctttggagccgcgctgtgtgctgagagtgtcaacaaggaga
                        *     ** **  *****  * * *   **   ***        ***** 

A0A5F5PML6_BCL2L2-      aggagcc------gggactggtcgag--------------------ggtg
A0A5F5PML6_BCL2L2-      tggagccacttgtgggacaagtgcaggagtggatggtggcctacctggag
A0A5F5PML6_BCL2L2-      tggagccacttgtgggacaagtgcaggagtggatggtggcctacctggag
                         ******      *****  **  **                    ** *

A0A5F5PML6_BCL2L2-      acccgg----------gggacggcgccattgaggacccggagctggaagc
A0A5F5PML6_BCL2L2-      actcggctggccgactggatccacagcagtggaggctgggagctggaagc
A0A5F5PML6_BCL2L2-      actcggctggccgactggatccacagcagtggaggctgggagctggaagc
                        ** ***          **  *  *  ** **  * *  ************

A0A5F5PML6_BCL2L2-      gatcaaagctcgagtcagggagatggaggaagaggctgagaagctaaaag
A0A5F5PML6_BCL2L2-      gatcaaagctcgagtcagggagatggaggaagaggctgagaagctaaaag
A0A5F5PML6_BCL2L2-      gatcaaagctcgagtcagggagatggaggaagaggctgagaagctaaaag

A0A5F5PML6_BCL2L2-      agctacagaacgaggttgagaagcagatgaatatgagtccacctccaggc
A0A5F5PML6_BCL2L2-      agctacagaacgaggttgagaagcagatgaatatgagtccacctccaggc
A0A5F5PML6_BCL2L2-      agctacagaacgaggttgagaagcagatgaatatgagtccacctccaggc

A0A5F5PML6_BCL2L2-      aatgctggcccagtgatcatgtccattgaggagaagatggaggctgatgc
A0A5F5PML6_BCL2L2-      aatgctggcccagtgatcatgtccattgaggagaagatggaggctgatgc
A0A5F5PML6_BCL2L2-      aatgctggcccagtgatcatgtccattgaggagaagatggaggctgatgc

A0A5F5PML6_BCL2L2-      tcgttccatctatgttggcaatgtggactatggtgcgacagcagaagagc
A0A5F5PML6_BCL2L2-      tcgttccatctatgttggcaatgtggactatggtgcgacagcagaagagc
A0A5F5PML6_BCL2L2-      tcgttccatctatgttggcaatgtggactatggtgcgacagcagaagagc

A0A5F5PML6_BCL2L2-      tggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactc
A0A5F5PML6_BCL2L2-      tggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactc
A0A5F5PML6_BCL2L2-      tggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactc

A0A5F5PML6_BCL2L2-      tgtgacaaatttagtggccatcccaaagggtttgcatatatagagttctc
A0A5F5PML6_BCL2L2-      tgtgacaaatttagtggccatcccaaagggtttgcatatatagagttctc
A0A5F5PML6_BCL2L2-      tgtgacaaatttagtggccatcccaaagggtttgcatatatagagttctc

A0A5F5PML6_BCL2L2-      agacaaagaatcagtgaggacttccctggccttagatgagtccctattta
A0A5F5PML6_BCL2L2-      agacaaagaatcagtgaggacttccctggccttagatgagtccctattta
A0A5F5PML6_BCL2L2-      agacaaagaatcagtgaggacttccctggccttagatgagtccctattta

A0A5F5PML6_BCL2L2-      gaggaaggcaaatcaaggtgatccctaaacgaaccaacagaccaggcatc
A0A5F5PML6_BCL2L2-      gaggaaggcaaatcaaggtgatccctaaacgaaccaacagaccaggcatc
A0A5F5PML6_BCL2L2-      gaggaaggcaaatcaaggtgatccctaaacgaaccaacagaccaggcatc

A0A5F5PML6_BCL2L2-      agtacaacagaccggggtttcccacgagcccgataccgtgccaggaccac
A0A5F5PML6_BCL2L2-      agtacaacagaccggggtttcccacgagcccgataccgtgccaggaccac
A0A5F5PML6_BCL2L2-      agtacaacagaccggggtttcccacgagcccgataccgtgccaggaccac

A0A5F5PML6_BCL2L2-      taactacaacagttcccgctctcgattctacagtggttttaacagcaggc
A0A5F5PML6_BCL2L2-      taactacaacagttcccgctctcgattctacagtggttttaacagcaggc
A0A5F5PML6_BCL2L2-      taactacaacagttcccgctctcgattctacagtggttttaacagcaggc

A0A5F5PML6_BCL2L2-      cccggggtcgcgtctacaggggccgggctagagcgacatcatggagatcg
A0A5F5PML6_BCL2L2-      cccggggtcgcgtctacaggggccgggctagagcgacatcatg-------
A0A5F5PML6_BCL2L2-      cccggggtcgcgtctacaggggccgggctagagcgacatcatggagatcg

A0A5F5PML6_BCL2L2-      tgcttgattctggtcaataccttcccactgactttggaataa
A0A5F5PML6_BCL2L2-      -----gtttctg---------------------------tag
A0A5F5PML6_BCL2L2-      tgcttgattctggtcaataccttcccactgactttggaataa
                             * *****                           ** 

© 1998-2020Legal notice