Dataset for CDS BAX-like of organism Amphilophus citrinellus

[Download (right click)] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A3Q0S613_BOK-01      atggaagtcctgcg--caagtcatcagta-----------tttgcttcgg
A0A3Q0RFY4_BOK-01      atggagatgttgcg--ccgctcctctgtg-----------tttgcctctg
A0A3Q0R008_BAX-01      atgtacagcatcatagcatctgttctgtgcagcaggaaccattgcatcag
A0A3Q0S1T8_BAX-01      ----------------------------gaagtgggaactattttgctaa
                                                                **       

A0A3Q0S613_BOK-01      aggtcttggacgtgtttgaccgatcgctgactgaaaaggagctggtgtcc
A0A3Q0RFY4_BOK-01      ---------aagtgtttgatcgctcgcccaccgacaaggagctggtgtcc
A0A3Q0R008_BAX-01      agcgctggaaa------------------acc----------tcaggtct
A0A3Q0S1T8_BAX-01      agg--------------------------act----------tcatctat
                                                    **           *    *  

A0A3Q0S613_BOK-01      cagtccaaggcactgtgcagagactacatcttgtccagactcacccagaa
A0A3Q0RFY4_BOK-01      caggccaaagcgctgtgcagggactacatccactccaggctgaaccgggc
A0A3Q0R008_BAX-01      gaggatgct--gatatgctcacttt-tcttcattgcatccaccacatgta
A0A3Q0S1T8_BAX-01      -----------------------------------------------gag
                                                                      *  

A0A3Q0S613_BOK-01      cgggttgggatggtccaaaactgagctca---atttttctccctcgaatg
A0A3Q0RFY4_BOK-01      cgggatcggctggtccaagcctgagcacg---gactgtctgcgtcaggtg
A0A3Q0R008_BAX-01      tgtgatcacacgcataaacacagaggaccctagtcggcatgtcacctctg
A0A3Q0S1T8_BAX-01      cgtgttcggagacatggagaca------g-caatactgtagtgacgaggg
                        * * *           *  *                       *    *

A0A3Q0S613_BOK-01      cagcgctggctgaagtgtc-------------------------------
A0A3Q0RFY4_BOK-01      ggactctgggagaaatatc-------------------------------
A0A3Q0R008_BAX-01      aggatctgggaggaaggccagatgaacaacaggatccacaaatcaaagaa
A0A3Q0S1T8_BAX-01      agcagctgggtggaac-ccagctgactgaccaaaaccataagag-----g
                            ****  * *    *                               

A0A3Q0S613_BOK-01      -----tatggtgcttctctgtcttggcgatgagctggagtgtatacagcc
A0A3Q0RFY4_BOK-01      -----gtcggtcctgctgtggctgggtgatgagttggagtgccttcgtcc
A0A3Q0R008_BAX-01      gtggtggaccagttgcgcaagatagcggatgagttaaa------------
A0A3Q0S1T8_BAX-01      cttgcacagtgcctgcagcagattggagatgagctgga------------
                                    * *      * *  ****** *  *            

A0A3Q0S613_BOK-01      tactttgtacaggaacgtggcgcggcagctcaacatttcagttgccatgg
A0A3Q0RFY4_BOK-01      caatgtgtaccgtaacgtcgcccgacagctgaacatcacagtggcgtcgg
A0A3Q0R008_BAX-01      ---------tcggaatgctgagcttcagggactgatcaaccaggttcagg
A0A3Q0S1T8_BAX-01      ---------tggaaatgtagagctccaaaggatgatagatgactcttcac
                                  * ** *  *  *  **       **              

A0A3Q0S613_BOK-01      agaacatggtttcggatgccttcatcggcgtagcaacagagattttctca
A0A3Q0RFY4_BOK-01      agggcgtggtgtccgatgccttcctggctgtcgctgcagacattttctcc
A0A3Q0R008_BAX-01      ggaactgtgctcaggacatcttcatggcggtggcaagaaacatctttgct
A0A3Q0S1T8_BAX-01      ttagtcccacaaaagacatttttctgaaagtggccattgagatcttctca
                                     **    **  *    ** **     * ** **  * 

A0A3Q0S613_BOK-01      gcaggca---taacatggggtaaggtggtgtccatgtatgcagtagctgg
A0A3Q0RFY4_BOK-01      acaggtg---tcacatggggaaaggtggtttccttgtacgctgtggcggg
A0A3Q0R008_BAX-01      gatggca---tcaactggggtcgaattgtggctctcttccatctggccta
A0A3Q0S1T8_BAX-01      gatggaaaatttaactggggcagggtggttgcactgttctactttgcatg
                          **     * *  *****     * **  *  * *      * **   

A0A3Q0S613_BOK-01      agccctggcagtggactgtgtcagacaaggccatccagccacagtacaca
A0A3Q0RFY4_BOK-01      agccttggcggtggactgtgtacgccacggtcatccagcaatggtccata
A0A3Q0R008_BAX-01      tagattaatatacaaggctcttaccaccaatcatttagagaacattcgaa
A0A3Q0S1T8_BAX-01      ccgactcgtcatcaaagctcttgtaacccaaattcctgatattatcagaa
                            *        *   * *            *   *  *   *    *

A0A3Q0S613_BOK-01      tcttagtggacagtctgggacagtttgtccgcaaattcctggttccctgg
A0A3Q0RFY4_BOK-01      ccattgttgactgcatgggggagtttgtccgcaagagtctgaccgcctgg
A0A3Q0R008_BAX-01      tggtcatcagctgggttcttcaagtcatcagagagcagctccacacctgg
A0A3Q0S1T8_BAX-01      ccattatcgtttggaccatggactaccttcgggaacatgtgatcaactgg
                          *  *     *        *     *  *  *     *      ****

A0A3Q0S613_BOK-01      ctgaagagacggggagggtgggtaagtatcacaaaatgtgtggtgaagaa
A0A3Q0RFY4_BOK-01      ttaaaaaggagaggaggctgggtggatgtaacgaagtgcgtggtgaacac
A0A3Q0R008_BAX-01      ctcgtgcagcaagggggctgggagggggtga-ttggtagtttttctcgat
A0A3Q0S1T8_BAX-01      atcagggagcaaggtggctgggagggtattcgctcctactttggcac-ac
                        *          ** ** ****      *       *   *       * 

A0A3Q0S613_BOK-01      ggatcttgctcctgaagaaaactggctgtcatccacctttgagtctctca
A0A3Q0RFY4_BOK-01      tgaccccagcttccactctcactggctggtgtctgctgtctgtgccttcg
A0A3Q0R008_BAX-01      ggaggacagtggccattgta--------------------gcatcagtag
A0A3Q0S1T8_BAX-01      ccacatggcagacggttggg--------------------gttttcttgg
                         *                                            *  

A0A3Q0S613_BOK-01      aatacttcctgaccacgctatatgtctacatcatgaaggagccgtaa
A0A3Q0RFY4_BOK-01      ggcactacctgaaggcggtcgtgctacacctcctccgggagaagtga
A0A3Q0R008_BAX-01      cattggtggtagcct------ttgtttactaccggaaagtacgatga
A0A3Q0S1T8_BAX-01      cgggagtcctcacca------ctgttcttgtcattcgcaagatgtga
                                *              *      *            * *

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice