Dataset for CDS BAK1 of Organism Coturnix japonica

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2U5S8_BAK1-03      atggaagggaacgaggg---------------------------------
A0A8C2U5S8_BAK1-01      atggtctggggttgggtttctattttttttttcctcccttcttttccctc
A0A8C2U5S8_BAK1-02      atggaagggaacgaggg---------------------------------
                        ****   **     **                                  

A0A8C2U5S8_BAK1-03      ---------ggacccaccca-----------------gggcccacagacg
A0A8C2U5S8_BAK1-01      ctcctccccggccctgctcgcttccttcccccgcgccgcgccgggagaag
A0A8C2U5S8_BAK1-02      ---------ggacccaccca-----------------gggcccacagacg
                                 ** **  * *                  * ***   *** *

A0A8C2U5S8_BAK1-03      gcag----------ggcagcaatgggcgcaggtcatcacgggagat----
A0A8C2U5S8_BAK1-01      gcaggaagggaggcggcggggatgga-gcagctccccg-gggggatgcag
A0A8C2U5S8_BAK1-02      gcag----------ggcagcaatgggcgcaggtcatcacgggagat----
                        ****          *** *  ****  **** **  *  *** ***    

A0A8C2U5S8_BAK1-03      --------------------caactca--------------------gag
A0A8C2U5S8_BAK1-01      tagctccctggggcaccccccgccccacctggtccccgccgggacgcgag
A0A8C2U5S8_BAK1-02      --------------------caactca--------------------gag
                                            *  * **                    ***

A0A8C2U5S8_BAK1-03      gaccaggtggcccagcagactgaggaggtgttccggagctacagcttcta
A0A8C2U5S8_BAK1-01      gaccaggtggcccagcagactgaggaggtgttccggagctacagcttcta
A0A8C2U5S8_BAK1-02      gaccaggtggcccagcagactgaggaggtgttccggagctacagcttcta
                        **************************************************

A0A8C2U5S8_BAK1-03      ccgctaccagcaggagagagaggagggaggggtggaggtgcccatggacc
A0A8C2U5S8_BAK1-01      ccgctaccagcaggagagagaggagggaggggtggaggtgcccatggacc
A0A8C2U5S8_BAK1-02      ccgctaccagcaggagagagaggagggaggggtggaggtgcccatggacc
                        **************************************************

A0A8C2U5S8_BAK1-03      cggagatcatggagatccagcaggagctgggcagcaccagcagccaggtg
A0A8C2U5S8_BAK1-01      cggagatcatggagatccagcaggagctgggcagcaccagcagccaggtg
A0A8C2U5S8_BAK1-02      cggagatcatggagatccagcaggagctgggcagcaccagcagccaggtg
                        **************************************************

A0A8C2U5S8_BAK1-03      ggcaggcgcctggccatcatcggggacgacatcaacaagcggtacgacgc
A0A8C2U5S8_BAK1-01      ggcaggcgcctggccatcatcggggacgacatcaacaagcggtacgacgc
A0A8C2U5S8_BAK1-02      ggcaggcgcctggccatcatcggggacgacatcaacaagcggtacgacgc
                        **************************************************

A0A8C2U5S8_BAK1-03      ggagttccgctgtatgctgaagtccttgcagcccaccaaggagaacgcct
A0A8C2U5S8_BAK1-01      ggagttccgctgtatgctgaagtccttgcagcccaccaaggagaacgcct
A0A8C2U5S8_BAK1-02      ggagttccgctgtatgctgaagtccttgcagcccaccaaggagaacgcct
                        **************************************************

A0A8C2U5S8_BAK1-03      accagtacttcaccaccatcgcctccagccatgctg--agctg------t
A0A8C2U5S8_BAK1-01      accagtacttcaccaccatcgcctccagcttgtttgatagcggcattaac
A0A8C2U5S8_BAK1-02      accagtacttcaccaccatcgcctccagcttgtttgatagcggcattaac
                        *****************************     **  *** *       

A0A8C2U5S8_BAK1-03      tggcaccgctttgccaccctgagg-----cggttaacgcgccgcaagcag
A0A8C2U5S8_BAK1-01      tggggccgggtgatcgcactgctggacttcggttactgcatggccatc--
A0A8C2U5S8_BAK1-02      tggggccgggtgatcgcactgctggacttcggttactgcatggccatc--
                        ***  ***  *   * * ***  *     ******  **   ** * *  

A0A8C2U5S8_BAK1-03      gtaaattaac---ctctgtcccttggtgctccctgtgtc----ctcctgc
A0A8C2U5S8_BAK1-01      -tacgtctaccagcacggcatcacgg-gcttcctgcgccgcatcgcccgc
A0A8C2U5S8_BAK1-02      -tacgtctaccagcacggcatcacgg-gcttcctgcgccgcatcgcccgc
                         **  *  **   * * *   *  ** *** **** * *    * ** **

A0A8C2U5S8_BAK1-03      tccatcccaggctccaaact------ccctttccctctgtga-----cca
A0A8C2U5S8_BAK1-01      tacgtcaccgaattcatgctgtgcaaccgcatcgcgcggtggatcgccca
A0A8C2U5S8_BAK1-02      tacgtcaccgaattcatgctgtgcaaccgcatcgcgcggtggatcgccca
                        * * ** * *  * **  **      **   ** * * ***      ***

A0A8C2U5S8_BAK1-03      gt------------------------------------------------
A0A8C2U5S8_BAK1-01      gcagggaggatgggtggctgcactcgatctggacaatgtttacatgaagt
A0A8C2U5S8_BAK1-02      gcagggaggatgggtggctgcactcgatctggacaatgtttacatgaagt
                        *                                                 

A0A8C2U5S8_BAK1-03      --------------gcagccctg-----------------------cagg
A0A8C2U5S8_BAK1-01      acatgctggcggtggtggccctggtgatggtggggcatttagtgcccagg
A0A8C2U5S8_BAK1-02      acatgctggcggtggtggccctggtgatggtggggcatttagtgcccagg
                                      *  ******                       ****

A0A8C2U5S8_BAK1-03      gacagccatgacagcaccaggttacaacgcagggctggagcc----tcct
A0A8C2U5S8_BAK1-01      ggcattcaagggacctctgagagagagagcagcg-tggacccgtcagcct
A0A8C2U5S8_BAK1-02      ggcattcaagggacctctgagagagagagcagcg-tggacccgtcagcct
                        * **  ** *  * * *   *  * *  **** * **** **     ***

A0A8C2U5S8_BAK1-03      cttact-----------------tttcttcttttatatttcttt------
A0A8C2U5S8_BAK1-01      cccactgcaggacatggggcctgtgccgcccaggagatgccaccgggagc
A0A8C2U5S8_BAK1-02      cccactgcaggacatggggcctgtgccgcccaggagatgccaccgggagc
                        *  ***                 *  *  *    * **  *         

A0A8C2U5S8_BAK1-03      ------------------tcttttccttcttgctaa
A0A8C2U5S8_BAK1-01      tacagagggaggggagggctctgctctgctgtctga
A0A8C2U5S8_BAK1-02      tacagagggaggggagggctctgctctgctgtctga
                                             *   ** **  ** *

© 1998-2023Legal notice