Dataset for CDS BAK1 of Organism Coturnix japonica

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C2U5S8_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Coturnix japonica GN=BAK1 (length=879 residues).
atggtctggggttgggtttctattttttttttcctcccttcttttccctcctcctccccggccctgctcgcttccttccc
ccgcgccgcgccgggagaaggcaggaagggaggcggcggggatggagcagctccccggggggatgcagtagctccctggg
gcaccccccgccccacctggtccccgccgggacgcgaggaccaggtggcccagcagactgaggaggtgttccggagctac
agcttctaccgctaccagcaggagagagaggagggaggggtggaggtgcccatggacccggagatcatggagatccagca
ggagctgggcagcaccagcagccaggtgggcaggcgcctggccatcatcggggacgacatcaacaagcggtacgacgcgg
agttccgctgtatgctgaagtccttgcagcccaccaaggagaacgcctaccagtacttcaccaccatcgcctccagcttg
tttgatagcggcattaactggggccgggtgatcgcactgctggacttcggttactgcatggccatctacgtctaccagca
cggcatcacgggcttcctgcgccgcatcgcccgctacgtcaccgaattcatgctgtgcaaccgcatcgcgcggtggatcg
cccagcagggaggatgggtggctgcactcgatctggacaatgtttacatgaagtacatgctggcggtggtggccctggtg
atggtggggcatttagtgcccaggggcattcaagggacctctgagagagagagcagcgtggacccgtcagcctcccactg
caggacatggggcctgtgccgcccaggagatgccaccgggagctacagagggaggggagggctctgctctgctgtctga
>gnl|bcl2dbcds|A0A8C2U5S8_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Coturnix japonica GN=BAK1 (length=768 residues).
atggaagggaacgagggggacccacccagggcccacagacggcagggcagcaatgggcgcaggtcatcacgggagatcaa
ctcagaggaccaggtggcccagcagactgaggaggtgttccggagctacagcttctaccgctaccagcaggagagagagg
agggaggggtggaggtgcccatggacccggagatcatggagatccagcaggagctgggcagcaccagcagccaggtgggc
aggcgcctggccatcatcggggacgacatcaacaagcggtacgacgcggagttccgctgtatgctgaagtccttgcagcc
caccaaggagaacgcctaccagtacttcaccaccatcgcctccagcttgtttgatagcggcattaactggggccgggtga
tcgcactgctggacttcggttactgcatggccatctacgtctaccagcacggcatcacgggcttcctgcgccgcatcgcc
cgctacgtcaccgaattcatgctgtgcaaccgcatcgcgcggtggatcgcccagcagggaggatgggtggctgcactcga
tctggacaatgtttacatgaagtacatgctggcggtggtggccctggtgatggtggggcatttagtgcccaggggcattc
aagggacctctgagagagagagcagcgtggacccgtcagcctcccactgcaggacatggggcctgtgccgcccaggagat
gccaccgggagctacagagggaggggagggctctgctctgctgtctga
>gnl|bcl2dbcds|A0A8C2U5S8_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Coturnix japonica GN=BAK1 (length=612 residues).
atggaagggaacgagggggacccacccagggcccacagacggcagggcagcaatgggcgcaggtcatcacgggagatcaa
ctcagaggaccaggtggcccagcagactgaggaggtgttccggagctacagcttctaccgctaccagcaggagagagagg
agggaggggtggaggtgcccatggacccggagatcatggagatccagcaggagctgggcagcaccagcagccaggtgggc
aggcgcctggccatcatcggggacgacatcaacaagcggtacgacgcggagttccgctgtatgctgaagtccttgcagcc
caccaaggagaacgcctaccagtacttcaccaccatcgcctccagccatgctgagctgttggcaccgctttgccaccctg
aggcggttaacgcgccgcaagcaggtaaattaacctctgtcccttggtgctccctgtgtcctcctgctccatcccaggct
ccaaactccctttccctctgtgaccagtgcagccctgcagggacagccatgacagcaccaggttacaacgcagggctgga
gcctcctcttacttttcttcttttatatttcttttcttttccttcttgctaa
© 1998-2023Legal notice