Dataset for CDS BAX of Organism Echeneis naucrates

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A665U5E7_BAX-01      atg-----------tccgacag-------ccaaggagaag--agggaaga
A0A665VGJ2_BAX-01      atggcatcatctcacccggcaggaggcgaccaaggaaataccaaagaaca
                       ***            *** ***       ******* *    *  *** *

A0A665U5E7_BAX-01      gacggcggcgagctggagcctcagggtgccgttgggggaggcgatgtcat
A0A665VGJ2_BAX-01      gatactgg-aagtaggtgct-----gttctgttgaag-----gatttcat
                       **    **  **  ** **      ** * ****  *     *** ****

A0A665U5E7_BAX-01      agatgatcccattctggagcaaggagcagtggtcctcagagggtatgtga
A0A665VGJ2_BAX-01      ctatcagcgggtgcagcaacatggag------------------atggca
                         ** * *   * * * * ** ****                  ***  *

A0A665U5E7_BAX-01      ttgaacggataaacacagaggaccctgctcgac--acgtcagctcagagg
A0A665VGJ2_BAX-01      atgcccaagtgacc----agggcacagctgggtggacgagagctc-gtgg
                        **  *   * * *    *** * * *** *    ***  ***** * **

A0A665U5E7_BAX-01      atctaggaggcaggccggatgaacaacatgatccacgagtgaaagaggtg
A0A665VGJ2_BAX-01      accca----------------aaccacaaga--------------aactt
                       * * *                *** *** **              *  * 

A0A665U5E7_BAX-01      gtagagcagttgctgaagattgcagatgatttggacagaaatgttgagtt
A0A665VGJ2_BAX-01      gctgagtgcctgcagaagattggagatgagctggatggaaatgttgagct
                       *  ***    *** ******** ******  ****  *********** *

A0A665U5E7_BAX-01      tcaacgactgattaaccaggttcagggaaactgtgctcaggacatcttca
A0A665VGJ2_BAX-01      ccaaaggatgataaacgacccctcagtcaatcccacaaaagacatgttct
                        *** *  **** *** *       *  **     *  * ***** *** 

A0A665U5E7_BAX-01      tgcaggtggccaggagcatcttcacagatggca---tcaactggggtcga
A0A665VGJ2_BAX-01      tgaaggttgccattgagattttttctgatggaaaattcaactggggcaga
                       ** **** ****     ** **  * ***** *   **********  **

A0A665U5E7_BAX-01      gtagtggccctcttccatctggcttacagactcatacacaaggcactgac
A0A665VGJ2_BAX-01      gtggttgcgctgttctactttgcctgtcgactcgtcatcaaagctcttgt
                       ** ** ** ** *** *  * ** *   ***** *   *** ** **   

A0A665U5E7_BAX-01      caccaaccatatagagaatatcaggatggtgatcagctgggttctccagg
A0A665VGJ2_BAX-01      gacccaagttcctgatattatcagaaccatcatcagctggaccatggact
                        *** *   *   ** * ****** *   * *********    *  *  

A0A665U5E7_BAX-01      tcatcagagagcagctctactcttggctcatacagcagggaggctgggag
A0A665VGJ2_BAX-01      acctccgggaaaatgtgatcaactggatcagggagcaaggaggctgggag
                        * ** * **  *  *   *   *** ***   **** ************

A0A665U5E7_BAX-01      ggggtgattcat---------ggcttttctcgatggaggacattcactgc
A0A665VGJ2_BAX-01      gg---cattcgttcctatttcggcactcccacatggcagacggtaggggt
                       **    **** *         ***  * *   ****  ***  *    * 

A0A665U5E7_BAX-01      agtagcatcagtagtgttggtggcagccattgtttactacagaaagacac
A0A665VGJ2_BAX-01      tttcttggccggtgtactcaccactgtcatcgtcattcgcaagatg----
                         *     * *  **  *     * * *** **      **  * *    

A0A665U5E7_BAX-01      gctga
A0A665VGJ2_BAX-01      --tga
                         ***

© 1998-2023Legal notice