Dataset for CDS BAX of Organism Echeneis naucrates

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A665U5E7_BAX-01 BCL2-associated X gene OS=[Eukaryota] Echeneis naucrates GN=BAX (length=621 residues).
atgtccgacagccaaggagaagagggaagagacggcggcgagctggagcctcagggtgccgttgggggaggcgatgtcat
agatgatcccattctggagcaaggagcagtggtcctcagagggtatgtgattgaacggataaacacagaggaccctgctc
gacacgtcagctcagaggatctaggaggcaggccggatgaacaacatgatccacgagtgaaagaggtggtagagcagttg
ctgaagattgcagatgatttggacagaaatgttgagtttcaacgactgattaaccaggttcagggaaactgtgctcagga
catcttcatgcaggtggccaggagcatcttcacagatggcatcaactggggtcgagtagtggccctcttccatctggctt
acagactcatacacaaggcactgaccaccaaccatatagagaatatcaggatggtgatcagctgggttctccaggtcatc
agagagcagctctactcttggctcatacagcagggaggctgggagggggtgattcatggcttttctcgatggaggacatt
cactgcagtagcatcagtagtgttggtggcagccattgtttactacagaaagacacgctga
>gnl|bcl2dbcds|A0A665VGJ2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Echeneis naucrates GN=BAX (length=582 residues).
atggcatcatctcacccggcaggaggcgaccaaggaaataccaaagaacagatactggaagtaggtgctgttctgttgaa
ggatttcatctatcagcgggtgcagcaacatggagatggcaatgcccaagtgaccagggcacagctgggtggacgagagc
tcgtggacccaaaccacaagaaacttgctgagtgcctgcagaagattggagatgagctggatggaaatgttgagctccaa
aggatgataaacgacccctcagtcaatcccacaaaagacatgttcttgaaggttgccattgagattttttctgatggaaa
attcaactggggcagagtggttgcgctgttctactttgcctgtcgactcgtcatcaaagctcttgtgacccaagttcctg
atattatcagaaccatcatcagctggaccatggactacctccgggaaaatgtgatcaactggatcagggagcaaggaggc
tgggagggcattcgttcctatttcggcactcccacatggcagacggtaggggttttcttggccggtgtactcaccactgt
catcgtcattcgcaagatgtga
© 1998-2023Legal notice