Dataset for CDS BCL-2-like of organism Salarias fasciatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A672JL90_BCL2L1-      ---------atgtcgtccagc------aaccgagagctggtggagttctt
A0A672HHE5_BCL2-01      ---------atg---gaaaacgagcgcaatcgcaatatcgtagtgaagta
A0A672IDC1_BCL2L1-      ---------atgtctgagaac---------cgggagctggtcgttttcta
A0A672IDC1_BCL2L1-      ---------atgtctgagaac---------cgggagctggtcgttttcta
A0A672GRK8_MCL1-01      atgaatattatgtcgacgaacaccaaacgggccgggttatttggctgcct
A0A672JQE9_BCL2L10      ----atgtcgtg----------------------------tgggctgc--
                                  **                            * *       

A0A672JL90_BCL2L1-      ttta--------------agccacaggctgtct--cagagga-accatcc
A0A672HHE5_BCL2-01      tatc--------------tgccataaactctcc--aaacgcg-gatacgc
A0A672IDC1_BCL2L1-      catc--------------acctacaaactgtcc--cagagga-actaccc
A0A672IDC1_BCL2L1-      catc--------------acctacaaactgtcc--cagagga-actaccc
A0A672GRK8_MCL1-01      tatttttccacaaaatggagtcatgcactacggatcagaggatcccaccc
A0A672JQE9_BCL2L10      ------------ggagagagaccctggctctgg--cagagga--ctacct
                                                   **       *  *      *   

A0A672JL90_BCL2L1-      gtcc----------------------------------------------
A0A672HHE5_BCL2-01      gtgg----------------------------------------------
A0A672IDC1_BCL2L1-      tctc----------------------------------------------
A0A672IDC1_BCL2L1-      tctc----------------------------------------------
A0A672GRK8_MCL1-01      atcagctccccatgggcgccggtgt--ggacactcttcacggtcacgtag
A0A672JQE9_BCL2L10      gtccctgcgctgcagaagcccatgtccggctcctcc--------------
                                                                          

A0A672JL90_BCL2L1-      --tccctgctgagaccg------caggatg-------------------c
A0A672HHE5_BCL2-01      --agcttggacgctgcg------cgggatgag---------------gac
A0A672IDC1_BCL2L1-      --aacc---acatagtg------ctcaatgagcctcccagcaggactgac
A0A672IDC1_BCL2L1-      --aacc---acatagtg------ctcaatgagcctcccagcaggactgac
A0A672GRK8_MCL1-01      agacccccaagcgaccgaagaacctggatgtagctgcggtgaacgggtac
A0A672JQE9_BCL2L10      --acctcccagcgagtca-----------gccgctgccatga---ggcac
                            *                        *                   *

A0A672JL90_BCL2L1-      acggcaaaggac---------------cga-------ggaa---------
A0A672HHE5_BCL2-01      gcggataataac---------------gggtccctagttga---------
A0A672IDC1_BCL2L1-      gggggggacggc---------------ggg---------ga---------
A0A672IDC1_BCL2L1-      gggggggacggc---------------ggg---------ga---------
A0A672GRK8_MCL1-01      gcgtcgaaaaacctccgggaggacagcgaagacgtggacgacgggtctct
A0A672JQE9_BCL2L10      atggcccaggacct-------------ggagaagcag-------------
                          *    *   *                                      

A0A672JL90_BCL2L1-      --------gaccagg------ccagctcatcgg--ccagcaatggctcgg
A0A672HHE5_BCL2-01      --------ccccgagccgactctggtccgccggtgccgggaggcggccgg
A0A672IDC1_BCL2L1-      --------cgccggg--gacgccgggtcg--ggccccgaccagcggacgg
A0A672IDC1_BCL2L1-      --------cgccggg--gacgccgggtcg--ggccccgaccagcggacgg
A0A672GRK8_MCL1-01      gccgtgcacaccggagctgcactcggacagtgaagcggac---------g
A0A672JQE9_BCL2L10      --------caccaggctcgcttccagtccctggcccagac---------c
                                  **               *   *   *              

A0A672JL90_BCL2L1-      tgtt--------cagcgg----------------cagtgctgg-------
A0A672HHE5_BCL2-01      agccgggcccgacagcgaggacgacagcccccgcctgtgcaggcggccgc
A0A672IDC1_BCL2L1-      agac--gcacgccaacggg-------------acttttaccagcaggagc
A0A672IDC1_BCL2L1-      agac--gcacgccaacggg-------------acttttaccagcaggagc
A0A672GRK8_MCL1-01      tgtcgtacagtgcagcggggagcgaa----------gtgctcgagagcga
A0A672JQE9_BCL2L10      ttcc---tgaggcagtgcgggccgga----------ccgct-----gcg-
                                    **  *                      *          

A0A672JL90_BCL2L1-      -gcggtcccagtctccacgcgccgaaactgaccctgtgaagtct------
A0A672HHE5_BCL2-01      agcagtccga---cccgcacgccgccatccac------------------
A0A672IDC1_BCL2L1-      agcgg---ga------gcccgccgccgtccccgctgcggcagctgggcgc
A0A672IDC1_BCL2L1-      agcgg---ga------gcccgccgccgtccccgctgcggcagctgggc--
A0A672GRK8_MCL1-01      cacgaggcagctcctcagccgctacttctcggaatttaccggac------
A0A672JQE9_BCL2L10      --------------tcagcc-------ttcggca----------------
                                           *                              

A0A672JL90_BCL2L1-      --------------------------------------------------
A0A672HHE5_BCL2-01      --------------------------------------------------
A0A672IDC1_BCL2L1-      tggcggcgggggcggggctggcggcgggggcggggctggcggcgggggcg
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A672GRK8_MCL1-01      --------------------------tttcaaagactcaaagaggcgaaa
A0A672JQE9_BCL2L10      --------------------------------------------------
                                                                          

A0A672JL90_BCL2L1-      --------------------------gcccttctggactccgccgacgag
A0A672HHE5_BCL2-01      -----------------------cgggtcctgcgggaggctggggacgaa
A0A672IDC1_BCL2L1-      gggccggcctggacgcggtgaaggaggccctgcgggacacggccaacgag
A0A672IDC1_BCL2L1-      -----------------------gaggccctgcgggacacggccaacgag
A0A672GRK8_MCL1-01      gtaaacccttatctactatgaagagggtcgtggaggacattctggcgaag
A0A672JQE9_BCL2L10      -------------------------ggtcatggaggagattgt-------
                                                  * * *   ***             

A0A672JL90_BCL2L1-      ttcgaacttctcttcaagcaagctttcagcgat-------ctttcctcgc
A0A672HHE5_BCL2-01      cttgagagactctaccagccggacttcacggag-------atgtcgcggc
A0A672IDC1_BCL2L1-      ttcgagctgcgctactccatggccttcagcgac-------ctgcacagcc
A0A672IDC1_BCL2L1-      ttcgagctgcgctactccatggccttcagcgac-------ctgcacagcc
A0A672GRK8_MCL1-01      cacagatacgcatacaatggtatgatcaacagattatctatggaagagag
A0A672JQE9_BCL2L10      --cggagatggacac-------------------------ttgaactggg
                                      *                                   

A0A672JL90_BCL2L1-      agctcgacatcactcccgacacggcctaccacagcttcaagagcgtgatg
A0A672HHE5_BCL2-01      agctgtacctcacctcctccacggcgcagaggaggttcgccgaggtgata
A0A672IDC1_BCL2L1-      agctgcacatcacgcccgccaccgcctaccagagcttcgagaacgtgatg
A0A672IDC1_BCL2L1-      agctgcacatcacgcccgccaccgcctaccagagcttcgagaacgtgatg
A0A672GRK8_MCL1-01      agggggagatttgaggttcctc------------c-------agtctgta
A0A672JQE9_BCL2L10      ggagggttgtttccattttcac------------ctttgctggggtggtg
                         *       *         * *                          * 

A0A672JL90_BCL2L1-      gacgag---gtcttcaaggatgg---cgtcaactgggggcgtatcgtagg
A0A672HHE5_BCL2-01      gacgaa---ctgttccgggacgg---ggtgaactggggccggattatcgc
A0A672IDC1_BCL2L1-      gacgag---gtgttccgggacgg---cgtcaactgggggcgcatcgtggg
A0A672IDC1_BCL2L1-      gacgag---gtgttccgggacgg---cgtcaactgggggcgcatcgtggg
A0A672GRK8_MCL1-01      gccaggacccttttctcagatgggagcaccaactggggtcgtattgccag
A0A672JQE9_BCL2L10      gccaga--cttatgctggaacagaaagac-------------gtcactaa
                        * *       * * *    *  *                    *      

A0A672JL90_BCL2L1-      cctgtttgccttcggcggcgtgctgtgcgtggagtgtgtg---gagaagg
A0A672HHE5_BCL2-01      cttcttcgagttcggtggcacggtgtgcgtggagtgcgtgtccaaggagg
A0A672IDC1_BCL2L1-      cctgttcgccttcggcggcgcgctgtgcgtggagtgcgtg---gagaagg
A0A672IDC1_BCL2L1-      cctgttcgccttcggcggcgcgctgtgcgtggagtgcgtg---gagaagg
A0A672GRK8_MCL1-01      cctggtggccttcggggcagttgtgtgtcaacacatgagg---gagcaag
A0A672JQE9_BCL2L10      ggggctggaccccgggacgg------gtcaggaact---g---ggacaag
                             * *    ***           *     *      *       * *

A0A672JL90_BCL2L1-      acatgagcgagctggtgtcacgcattgcagactggatgaccatgtacctg
A0A672HHE5_BCL2-01      acatgacggcgcaggtggacaacatcgcggactggatgacggagtattta
A0A672IDC1_BCL2L1-      agatgagccccctggtggggaggatcgtggagtggatgacggtctacctg
A0A672IDC1_BCL2L1-      agatgagccccctggtggggaggatcgtggagtggatgacggtctacctg
A0A672GRK8_MCL1-01      gcaggccagactgtgtggagctggtgggccaggagatttccacatacctg
A0A672JQE9_BCL2L10      agaccgtaaactgcagggcactggcgg---agaccatagctgaatacttt
                          *             *         *   *    **  *    **  * 

A0A672JL90_BCL2L1-      gatgagaacatcaatttctggattgagagccaggggggatgggaatactt
A0A672HHE5_BCL2-01      aatggacctcttgacagctggatacgggataacgggggatgggatgcgtt
A0A672IDC1_BCL2L1-      gacaaccacatccagccctggatccagagccaagggggatgggagcgctt
A0A672IDC1_BCL2L1-      gacaaccacatccagccctggatccagagccaagggggatgggagcgctt
A0A672GRK8_MCL1-01      ctgagtgaacagagagactggctgatcaagaacaactcctgggatggttt
A0A672JQE9_BCL2L10      ggaggggagaagaaagactggatgttggagaatgacggatgggagggctt
                                         **** *        *       *****    **

A0A672JL90_BCL2L1-      cgctgagattttcgggcgtggcgctgcttcagaggcgaggagatcccggg
A0A672HHE5_BCL2-01      tgt--ggatct----gtacgac----cggcagaggg-----agtccg---
A0A672IDC1_BCL2L1-      tgccgagatcttcgggcaggacgcggcggcggagggccggcggtccgagg
A0A672IDC1_BCL2L1-      tgccgagatcttcgggcaggacgcggcggcggagggccggcggtccgagg
A0A672GRK8_MCL1-01      tgtagag-t--------tcttccatgtagcagac---------cctgagt
A0A672JQE9_BCL2L10      ctgtgcg-tacgcccgcactgccagacaggcgag---------cctggac
                              * *            *         **           *     

A0A672JL90_BCL2L1-      agaagatgacgaggtggctgctagttg-------gggtggcgctgct---
A0A672HHE5_BCL2-01      ---tcttca-------gctgctcgtggccgtccataaagacggtgttcgg
A0A672IDC1_BCL2L1-      agagcttcaggaagtggctgctggtgg-------ggatgacggtggt---
A0A672IDC1_BCL2L1-      agagcttcaggaagtggctgctggtgg-------ggatgacggtggt---
A0A672GRK8_MCL1-01      ctacggtcagaaacacgctcatggctgttgcaggatttgcaggcata---
A0A672JQE9_BCL2L10      t--cgtccatgaagacggcgctgttcgctgc------tgctggcgtt---
                                *       *    *    *           *  *        

A0A672JL90_BCL2L1-      ----agcggg---agtgctg-----------atcg---------------
A0A672HHE5_BCL2-01      cctggccgcgctcggcgccgccagcctcaccatcg---------------
A0A672IDC1_BCL2L1-      ----gacgggcttcgtggtg---ggctcgctgt-----------------
A0A672IDC1_BCL2L1-      ----gacgggcttcgtggtg---ggctcgctgt-----------------
A0A672GRK8_MCL1-01      -------ggggcaactctggccctgctcatcagctgtagtggtaaaggtt
A0A672JQE9_BCL2L10      -------gg------cctcgccgggctcaccttcc---------------
                               *           *                              

A0A672JL90_BCL2L1-      -----------------------------gcgtgggcatcgctaa-----
A0A672HHE5_BCL2-01      -----------------------------gagcgtacctcaccca-----
A0A672IDC1_BCL2L1-      --------------------------------------tcgccca-----
A0A672IDC1_BCL2L1-      --------------------------------------tcgccca-----
A0A672GRK8_MCL1-01      tgaaaacgagtcccaggccaaaacgggaagagcaagctgcactagtccct
A0A672JQE9_BCL2L10      ----------tcctgg---------------------tgcgctag-----
                                                               * *        

A0A672JL90_BCL2L1-      --gagaca---gtga
A0A672HHE5_BCL2-01      --gaa------gtga
A0A672IDC1_BCL2L1-      --gaagcgcctgtga
A0A672IDC1_BCL2L1-      --gaagcgcctgtga
A0A672GRK8_MCL1-01      gttgtgcagccatga
A0A672JQE9_BCL2L10      ---------------
                                       

© 1998-2020Legal notice