Dataset for CDS BCL-2-like of organism Scleropages formosus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A8C9SET9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Scleropages formosus GN=BCL2L1 (length=675 residues).
atgtcctacagcaacagagagctggtggagttctacgtcagctacaagctggcccagaagaactactcgtttgcccactt
cgtgccggaaagggcccgcgaggagaatgaagacccgggcactaccgaggttgggagggctcgcaccaacggcgcggtga
gcaggggcgcctctcctggaccagcgacgctgccggagccccgctctcggggcctgcaggcggtgaaggaagcgctgcgc
gactctgccaacgagtttgagctgcgctaccagcgcgccttcagcgacttgtcgtcacagctgcacatcacgcccggcac
ggcgtaccagagcttcgagagcgtcatgaacgaggtgttccgcgacggcgtcaactggggccgcatcgtagggctttttg
ccttcgggggagcactttgcgtcgagtgcgttgagaaggagatgagccacttggtggcccgcatcatggactggatgacg
gtctacttggacaaccacatccagccctggatccagagccaaggaggatgggaccgctttgccgagatctttgggaacga
cgcggcggcggagagcaggcggtggcgggagaacgtctcctggtggctcatggccggcctcgtgctgtttgtcggtgccg
tgctcggctccatcgtcgccaagaggtgccagtga
>gnl|bcl2dbcds|A0A8C9SVL8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Scleropages formosus GN=BCL2L1 (length=702 residues).
atgtcgtacagcaacagggaactggtgaagttttatataagctataaactgtcccaaaggaactactgtagtcactttga
gtttcccgaggacgggagtcggaccgagcgctcggatcaggcggaagcgaacggggaggaggcgttggccgccgctcatg
cgaacgggtctgcgaacggagggagtcggggattggggcagccgcccccgttgccctcctcctccccgcccccgcggggc
acgaaggcggtgaaggaggcgctgcgggacgcggccaacgagtttgagctgcgctacaaccgcgccttcaccgacctctc
ctctcagctgcacatcacgccggcgacggcctaccggagcttcgagagcgtgatgaacgaggtgttccgcgacgacgtga
actgggggcgcatcgttggcctctttgcgttcggaggagccctctgcgtcgagtgcgtggagaaggagatgagctacctg
gtgggccgcatagcagactggatgaccgtctacctggacaacaacatccagccctggatccaaaaccaaggaggatggga
ccgatttgcggagatctacgggaacgatgccgccgccaacagcaggcggtcccaggagaacatgaagaagtggctttttg
ccggggtaacgcttgtgatgggagtgctggtggcctccatcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C9T5U7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Scleropages formosus GN=BCL-2 (length=735 residues).
atggcaaacgagggcgcgtacgacagccgggacatcgtggaagtgtacctgtaccacaagctgctcaagacgggctatgt
gtgggaattccgcgccgccgccgccgccgacgccgatccctccaataacggattaacggactccggctcgcccggcttgc
ccgggtcgcccggctcccaggtggtggcacggaggtcgcaggctgccggggccgcggacgcagaggacgcgcccctctcc
cgcagccgcgcgccccactgcgacccccgctgcgaccaccacgccgcactgcaccgggtcctgcgcgaggcgggcgacga
gatcgagcggatgtaccagcgggacttcgcgcagatgcccgagcggctgcacttcacgcccagcacggcgcagcgcaagt
tcacggccgtcatcgaggagctcttcagcgacggcgtgaactgggggcgcatcgtggcctttttcgagttcgggggcacc
atgtgcgtggagagcgtgaaccgggagatgacgtcccaggtggataacattgcgcgctggatgacggagtatctaaacgg
acccctccgtaactggatccaggaaaatggaggatgggatgccttcgtggagctctacgggcagcagaggggctccgtgt
tccgctgttcctggccgtacataaagaccgttttcggtctggccgctttgggagcggccggcgtcaccatcggggcgtac
ctcacccacaagtga
>gnl|bcl2dbcds|A0A8C9VMU9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scleropages formosus GN=MCL-1 (length=966 residues).
atgtggacagcgagtagctacaagtgccgcgacgagacgctttctgtgaacgggttatacatgtttaataattcattttt
tccaaaaatgagtcagtcgatgatgaagcctcctcacaccagttttatggacatttgctgtccgggaaataaagctcgag
gtggaggaacgaactatcaggacggctcagacaaagcgccccaggtggctctggcctctgaggtggaggacgagctgctc
tacgggctggatgaggtggacagctgcctccgctctcccaaaacggggggaaaaggaactccaaaaaagctcgtcttgga
gaggctcgtcccgaagtcgaggagcggcggggtcgaggataatggttctctgccttgtactccgggcaactcgccgacga
cggaatgcggacaaatgtgcgagttccacgacaatcatggcgacgaattgttggagcgggagacgcacgagttgctgggg
gatttcctactgctgtacgctgggatgtttcaggggaagccgagacggagcagagctctgcgcaccatgcagcgcgtcgt
ggaagatgtgctcctgaagcacagatttacatacaaaggtatgatttcaaagcagaggctggagcaggaaagtgatgaca
tgggcttcattaaagctgttgcccagaacctcttcagtgatcaggtgacaaattggggccgcatcgttggcctggtagcg
tttggcgcagaggtgagcaagcacctgaaggagagtgggcgtgagcactgcatcgggacagttggggcacagatctctac
ttacctcctcactgagcaaagagagtggctgctcaacaataaggcctgggaaggatttgtggagttcttcaccattgaag
atgctgagtcggtggtgagaaattcccttcttgcatttgcaaccatggcgtggatagggctaggaattgcatacttcatg
aaatga
>gnl|bcl2dbcds|A0A8C9WE28_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scleropages formosus GN=MCL-1 (length=840 residues).
atgagtatgtcaacgatgaaccgcgtttccgctgttagtctgctctgccccggtgttaaggccaaagttttcgaccaagg
cccgttcccagccgcctcgtccggctcctccaagctgccgagcgaggaggagctggacgacgtgtccgatgaggtggact
ccgctccggcccccatcaagtcctccagcaagctctccttccccggcggcttccagcagagctccaacgcggacggctct
ctgccaaactcccccccggactcgccggatagctccccggacgcgccgctggccgcctgctgcttcccgaaggctgacgc
gcagctcgagcgcgacacccgcgcgctcgtcggcgccttcctgcgctcgttcgcgggcctgagccgcggcgactgcgccc
agtcgcgcgcgctgcccgtgatgcggcgcgtggttgaagagctgctcgagaagcatcacctggtgtaccagggtatgatt
caaaagctggatgtagaccatcgagaagatgacactagttttgtcacagctgtggccaagaacctcttcagtgatggaca
caccaactggggccgcatcgccagcctcatcgcgtttggtgctgttgtctgccagcgtctgaaggacagcggcagggagc
actgtgtagacagtgtcgccagtcagatctcctcttacctagtgacagagcaacaagattggttgagcaacaataaaggc
tgggagggctttgttgacttcttccatattgaggacacggagtctctagtgagaaatgcccttatggctttcgcaggggt
tgcaggaattggggctggacttgctcttctcatccggtga
© 1998-2023Legal notice