Dataset for CDS BCL-2-like of organism Scleropages formosus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9VMU9_MCL1-01      atgtggacagcgagtagctacaagtgccgcgacgagacgctttctgtgaa
A0A8C9WE28_MCL1-01      atg-------------agtatgtcaacgatgaaccg--------------
A0A8C9T5U7_BCL2-01      atggcaaacgagggcgcgtacgacagccgggacatcgtg-----------
A0A8C9SET9_BCL2L1-      atg------------tcctacagcaacagagagctggtg-----------
A0A8C9SVL8_BCL2L1-      atg------------tcgtacagcaacagggaactggtg-----------
                        ***               **      *   **                  

A0A8C9VMU9_MCL1-01      cgggttatacatgtttaataattcattttttccaaaaatgagtcagtcga
A0A8C9WE28_MCL1-01      -------cgtttccgctgttagtctgctct--------------------
A0A8C9T5U7_BCL2-01      -gaagtgtacctgtaccacaag------ct--------------------
A0A8C9SET9_BCL2L1-      -gagttctacgtcagctacaag------ct--------------------
A0A8C9SVL8_BCL2L1-      -aagttttatataagctataaa------ct--------------------
                                   *        *        *                    

A0A8C9VMU9_MCL1-01      tgatgaagcctcctcacaccagttttatggacatttgctgtccgggaaat
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A8C9T5U7_BCL2-01      --------------------------------------------------
A0A8C9SET9_BCL2L1-      --------------------------------------------------
A0A8C9SVL8_BCL2L1-      --------------------------------------------------
                                                                          

A0A8C9VMU9_MCL1-01      aaagctcgaggtggaggaacgaactatc------aggacggctcagacaa
A0A8C9WE28_MCL1-01      ---gccccggtgttaaggccaaagttttcgaccaaggcccgttcccagcc
A0A8C9T5U7_BCL2-01      ---gctcaag----acgggctatgtgtggga---------attccgcgcc
A0A8C9SET9_BCL2L1-      ---ggcccag----aagaactactcgtt----------------------
A0A8C9SVL8_BCL2L1-      ---gtcccaa----aggaactac---tg----------------------
                           *  *       * *  * *    *                       

A0A8C9VMU9_MCL1-01      agcgccccaggtggctctggcctctgaggtggaggacgagctgctctacg
A0A8C9WE28_MCL1-01      gcctcgtccggctcctccaagctgccgag-cgaggaggagctggacgacg
A0A8C9T5U7_BCL2-01      gccgccgccgccgacgccgatccctccaa-taacggattaacggactccg
A0A8C9SET9_BCL2L1-      --------tgcccacttcgtgcc-------ggaaag-------------g
A0A8C9SVL8_BCL2L1-      --------tagtcactttgagtttcccga-ggacgg-------------g
                                      *                 *                *

A0A8C9VMU9_MCL1-01      ggctggatgaggtggacagctgcctccgctctcccaaaacggggggaaaa
A0A8C9WE28_MCL1-01      tgtccgatgaggtggactccgctc---cggccccca--tca--------a
A0A8C9T5U7_BCL2-01      gctc--gcccggcttgcccgggtcgcccggctcccaggtgg--------t
A0A8C9SET9_BCL2L1-      gccc--gcgaggagaatgaagacc---cgggcacta--ccg--------a
A0A8C9SVL8_BCL2L1-      agtc--ggaccgagcgctcggatcaggcggaagcga--acg--------g
                                   *           *         * *              

A0A8C9VMU9_MCL1-01      ggaactccaaaaaagctcgtcttggagaggctcgtcccgaagtcgaggag
A0A8C9WE28_MCL1-01      gtcctccagcaagctctccttccccggcggcttccagcagagctccaacg
A0A8C9T5U7_BCL2-01      gg--------------------cacggagg-----------tcgc--agg
A0A8C9SET9_BCL2L1-      gg--------------------ttgggagg-----------gctc--gca
A0A8C9SVL8_BCL2L1-      gg----------------------aggaggcgttggccgccgctc--atg
                        *                         * **                    

A0A8C9VMU9_MCL1-01      cggcggggt------------------cgaggataatggttctctgcctt
A0A8C9WE28_MCL1-01      cggacggctctctgccaaactcccccccggactcgccggatagctccccg
A0A8C9T5U7_BCL2-01      ctgccgggg---------------ccgcggacgcaga------------g
A0A8C9SET9_BCL2L1-      ccaacggcg---------------cggtgagc--aggggcgcctctcctg
A0A8C9SVL8_BCL2L1-      cgaacgggt---------------ctgcgaacggagggagtcggggattg
                        *    **                     *                     

A0A8C9VMU9_MCL1-01      g---tactccgggcaactcgccgacgacggaatgcggacaaa--------
A0A8C9WE28_MCL1-01      gacgcgccgctggccgcctgctgcttcccgaaggctgacgcg-cagctcg
A0A8C9T5U7_BCL2-01      gacgcgcccct-------------ctcccgcagccgcgcgcc------cc
A0A8C9SET9_BCL2L1-      gaccagcgacg-------------ctgccggagccccgctct--------
A0A8C9SVL8_BCL2L1-      gggcagc--cg-------------cccccgttgccctcctcctccccgcc
                        *     *  *                 * *    *   *           

A0A8C9VMU9_MCL1-01      tgtgcgagttccacgacaatcatggcgacgaattgttggagcgggagacg
A0A8C9WE28_MCL1-01      agcgcgacacccgc---------------g---cgctcgtcggcgccttc
A0A8C9T5U7_BCL2-01      actgcgacccccgctgcgaccaccacgccg---cactgcaccgggtcctg
A0A8C9SET9_BCL2L1-      ----cggggcctgcag-------------g---cggtgaaggaagcgctg
A0A8C9SVL8_BCL2L1-      cccgcggggcacgaag-------------g---cggtgaaggaggcgctg
                            **                       *      *       *     

A0A8C9VMU9_MCL1-01      cacgagttgctgggggatttcctactgctgtacgctgggatgtttcaggg
A0A8C9WE28_MCL1-01      ctgcgctcgttcg-cgggcctgagccgcg---------------------
A0A8C9T5U7_BCL2-01      cgcgaggcgggcgacgagatcgagcggatgtac-----------------
A0A8C9SET9_BCL2L1-      cgcgactctgccaacgagtttgagctgcgctac-----------------
A0A8C9SVL8_BCL2L1-      cgggacgcggccaacgagtttgagctgcgctac-----------------
                        *              *        * *                       

A0A8C9VMU9_MCL1-01      gaagccgagacggagcagagctctgcgcac-------catgcagcgcgtc
A0A8C9WE28_MCL1-01      ------gcgactgcgcccagtcgcgcgcgctgcccgtgatgcggcgcgtg
A0A8C9T5U7_BCL2-01      --cagcgggacttcgcgcagatgcccgagc--------------------
A0A8C9SET9_BCL2L1-      --cagcgcgccttcagcgacttgtcgtcac--------------------
A0A8C9SVL8_BCL2L1-      --aaccgcgccttcaccgacctctcctctc--------------------
                              * * *       *          *                    

A0A8C9VMU9_MCL1-01      gtggaagatgtgctcctgaagcacagatttacatacaaaggtatgatttc
A0A8C9WE28_MCL1-01      gttgaagagctgctcgagaagcatcacctggtgtaccagggtatgattca
A0A8C9T5U7_BCL2-01      -------ggctgcacttcacgcccagcacggcgcagcgcaag----ttca
A0A8C9SET9_BCL2L1-      -------agctgcacatcacgcccggcacggcgtaccagagc----ttcg
A0A8C9SVL8_BCL2L1-      -------agctgcacatcacgccggcgacggcctaccggagc----ttcg
                                  *** *   * **            *           **  

A0A8C9VMU9_MCL1-01      aaagcagaggctggagcaggaaagtgatgacatgggcttcattaaagctg
A0A8C9WE28_MCL1-01      aaagctggatgtagaccatcgagaagatgacactagttttgtcacagctg
A0A8C9T5U7_BCL2-01      cggcc--------------------------------------------g
A0A8C9SET9_BCL2L1-      agagc--------------------------------------------g
A0A8C9SVL8_BCL2L1-      agagc--------------------------------------------g
                            *                                            *

A0A8C9VMU9_MCL1-01      ttgcccagaacctcttcagtgatcaggtgacaaattggggccgcatcgtt
A0A8C9WE28_MCL1-01      tggccaagaacctcttcagtgatggacacaccaactggggccgcatcgcc
A0A8C9T5U7_BCL2-01      tcatcgaggagctcttcagcgacgg---cgtgaactgggggcgcatcgtg
A0A8C9SET9_BCL2L1-      tcatgaacgaggtgttccgcgacgg---cgtcaactggggccgcatcgta
A0A8C9SVL8_BCL2L1-      tgatgaacgaggtgttccgcgacga---cgtgaactgggggcgcatcgtt
                        *     *  *  * *** * **          ** ***** *******  

A0A8C9VMU9_MCL1-01      ggcctggtagcgtttggcgcagaggtgagcaagcacctgaaggagagtgg
A0A8C9WE28_MCL1-01      agcctcatcgcgtttggtgctgttgtctgccagcgtctgaaggacagcgg
A0A8C9T5U7_BCL2-01      gcctttttcgagttcgggggcaccatgtgc------gtggagagcgtgaa
A0A8C9SET9_BCL2L1-      gggctttttgccttcgggggagcactttgc------gtcgagtgcgttga
A0A8C9SVL8_BCL2L1-      ggcctctttgcgttcggaggagccctctgc------gtcgagtgcgtgga
                            *  * *  ** ** *      *  **       *  **        

A0A8C9VMU9_MCL1-01      gcgtgag------cactgcatcgggacagttggggcacagatctctactt
A0A8C9WE28_MCL1-01      cagggag------cactgtgtagacagtgtcgccagtcagatctcctctt
A0A8C9T5U7_BCL2-01      ccgggagatgacgtcccaggtggataacattgcgcgctggatgacggagt
A0A8C9SET9_BCL2L1-      gaaggagatgagccacttggtggcccgcatcatggactggatgacggtct
A0A8C9SVL8_BCL2L1-      gaaggagatgagctacctggtgggccgcatagcagactggatgaccgtct
                            ***        *    * *      *         ***  *    *

A0A8C9VMU9_MCL1-01      acctcctcactgagcaaagagagtggctgctcaacaataaggcctgggaa
A0A8C9WE28_MCL1-01      acctagtgacagagcaacaagattggttgagcaacaataaaggctgggag
A0A8C9T5U7_BCL2-01      atctaaacggacccctccgtaactggatccaggaaaatggaggatgggat
A0A8C9SET9_BCL2L1-      acttggacaaccacatccagccctggatccagagccaaggaggatgggac
A0A8C9SVL8_BCL2L1-      acctggacaacaacatccagccctggatccaaaaccaaggaggatgggac
                        *  *                   *** *        *    *  ***** 

A0A8C9VMU9_MCL1-01      ggatttgtggagttcttcaccattgaagatgc-----------tgagtcg
A0A8C9WE28_MCL1-01      ggctttgttgacttcttccatattgaggacac-----------ggagtct
A0A8C9T5U7_BCL2-01      gccttcgtggagctctacgggcagcagaggggctccgtgttccgctgttc
A0A8C9SET9_BCL2L1-      cgctttgccgagatctttgggaacgacgcggcggcggagagcaggcggtg
A0A8C9SVL8_BCL2L1-      cgatttgcggagatctacgggaacgatgccgccgccaacagcaggcggtc
                           ** *  **  ***         *                    *   

A0A8C9VMU9_MCL1-01      gtggtgagaaattcccttcttgcatttgc----aaccatggcgtggatag
A0A8C9WE28_MCL1-01      ctagtgagaaatgcccttatggctttcgcaggggt---tgcaggaattgg
A0A8C9T5U7_BCL2-01      ctggccgtacat--aaagaccgttttcggtctggc---cgctt----tgg
A0A8C9SET9_BCL2L1-      gcgggagaacgtctcctggtggctcatggccggcctcgtgctgtttgtcg
A0A8C9SVL8_BCL2L1-      ccaggagaacatgaagaagtggctttttgccggggtaacgcttgtgatgg
                           *    *  *         *                 *       * *

A0A8C9VMU9_MCL1-01      ggctaggaattgcatact------------tcatgaa---------atga
A0A8C9WE28_MCL1-01      ggctggacttgctcttc-------------tcatccg---------gtga
A0A8C9T5U7_BCL2-01      gagcggccggcgtcaccatcggggcgtacctcacccacaa------gtga
A0A8C9SET9_BCL2L1-      gtgccgtgctcggctccatcg---------tcgccaagaggtgccagtga
A0A8C9SVL8_BCL2L1-      gagtgctggtggcctccatca---------tcgcccagaaacgcctgtga
                        *               *             **               ***

© 1998-2023Legal notice