Dataset for CDS MCL-1 of organism Terrapene carolina triunguis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A674IPL6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Terrapene carolina triunguis GN=MCL-1 (length=960 residues).
atgttggcgttaaagcggaacgcggtgatcggcctcaacctgtactgcgggggcggcccgacgctgcccccctccccgcc
gggctccccgagcggcgcggggaccccccccgcccccggcgcgcgggaccccggccctccggcgacgctgattggcggag
cctcttggggtgccaacggtcattctgagggggcccgggcgctgattggctcccccgccaccccccctgcgcggggggcc
ggggggccccggccggccccgctgtggcggccggaagaggaactggacggctgcgaccccgacgccgagaggacgggccc
gccggcggccgccgcccacgccgacggctccttgcccagcaccccgcccgcggaggacgacgacgagctggacgggctgt
tccaggactcgctggagctcatcagccgctacctgcgggaggccgcggagctgggcgcgcccggcggcaagacgctcttc
aagcggctgctgagcgggccgcggggggcgggccccgccgccctggagaaggcgctggagacgctgcggagggtcggcga
cggcgtcatggagaagcaccagatcgccttccaagggatgcttcggaagctagacatcaagaatgaggaggatctgaagt
cagtgactgccgttgcaacccatgttttcagtgatggagtaacaaactggggtagaattgtgacactcatctcttttggt
gcctttgttgcaaaacacctgaagagcataaaccaggagaattgcatcaacacactagcagggatcatcacagatgtgct
tgtcacaggcaaacgagattggctagttaaccaaagaggctgggagggatttgttgaattcttccgtgtagaggatctag
aaggtagcatcaggaatgttctggtggcttttgcaggctttgctggactgggagcaagcttggcctacatgatgcgatga
>gnl|bcl2dbcds|A0A674JQC4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Terrapene carolina triunguis GN=MCL-1 (length=456 residues).
atggagaaggtgctgaagacgctgcggagggtcggcgatggcgtcattgagaagcagcagatcgccttccaagggatgct
tcggaagctagacatcaagcatgaggaggatctgaagtcagtaactgctgttgcaacccatattttcaatgatggggtaa
caaactggggtagaattctttcgtgggtaaaaacctcacttgcatcactcatctcttttggtgcctttgttgtaaaacac
ctgaagagcataaaccaggagaattgcatcaacacactagcagggatcatcacagatgtgcttgtcacaggcaaacgaca
ttggttagttaaccaaagaggctgggagggatttgttgaattcttctgtgtagaggatctagaaggtagcagcatcagga
atgttctggtggcttttgctggactgggagaatccttggcctacatgatgcaatga
© 1998-2023Legal notice