Dataset for CDS MCL-1 of organism Terrapene carolina triunguis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A674IPL6_MCL1-01      atgttggcgttaaagcggaacgcggtgatcggcctcaacctgtactgcgg
A0A674JQC4_MCL1-01      a-------------------------------------------------
                        *                                                 

A0A674IPL6_MCL1-01      gggcggcccgacgctgcccccctccccgccgggctccccgagcggcgcgg
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674IPL6_MCL1-01      ggaccccccccgcccccggcgcgcgggaccccggccctccggcgacgctg
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674IPL6_MCL1-01      attggcggagcctcttggggtgccaacggtcattctgagggggcccgggc
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674IPL6_MCL1-01      gctgattggctcccccgccaccccccctgcgcggggggccggggggcccc
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674IPL6_MCL1-01      ggccggccccgctgtggcggccggaagaggaactggacggctgcgacccc
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674IPL6_MCL1-01      gacgccgagaggacgggcccgccggcggccgccgcccacgccgacggctc
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674IPL6_MCL1-01      cttgcccagcaccccgcccgcggaggacgacgacgagctggacgggctgt
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674IPL6_MCL1-01      tccaggactcgctggagctcatcagccgctacctgcgggaggccgcggag
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674IPL6_MCL1-01      ctgggcgcgcccggcggcaagacgctcttcaagcggctgctgagcgggcc
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674IPL6_MCL1-01      gcggggggcgggccccgccgccctggagaaggcgctggagacgctgcgga
A0A674JQC4_MCL1-01      -----------------------tggagaaggtgctgaagacgctgcgga
                                               ********* **** ************

A0A674IPL6_MCL1-01      gggtcggcgacggcgtcatggagaagcaccagatcgccttccaagggatg
A0A674JQC4_MCL1-01      gggtcggcgatggcgtcattgagaagcagcagatcgccttccaagggatg
                        ********** ******** ******** *********************

A0A674IPL6_MCL1-01      cttcggaagctagacatcaagaatgaggaggatctgaagtcagtgactgc
A0A674JQC4_MCL1-01      cttcggaagctagacatcaagcatgaggaggatctgaagtcagtaactgc
                        ********************* ********************** *****

A0A674IPL6_MCL1-01      cgttgcaacccatgttttcagtgatggagtaacaaactggggtagaa---
A0A674JQC4_MCL1-01      tgttgcaacccatattttcaatgatggggtaacaaactggggtagaattc
                         ************ ****** ****** *******************   

A0A674IPL6_MCL1-01      ---------------------ttgtgacactcatctcttttggtgccttt
A0A674JQC4_MCL1-01      tttcgtgggtaaaaacctcacttgcatcactcatctcttttggtgccttt
                                             ***   ***********************

A0A674IPL6_MCL1-01      gttgcaaaacacctgaagagcataaaccaggagaattgcatcaacacact
A0A674JQC4_MCL1-01      gttgtaaaacacctgaagagcataaaccaggagaattgcatcaacacact
                        **** *********************************************

A0A674IPL6_MCL1-01      agcagggatcatcacagatgtgcttgtcacaggcaaacgagattggctag
A0A674JQC4_MCL1-01      agcagggatcatcacagatgtgcttgtcacaggcaaacgacattggttag
                        **************************************** ***** ***

A0A674IPL6_MCL1-01      ttaaccaaagaggctgggagggatttgttgaattcttccgtgtagaggat
A0A674JQC4_MCL1-01      ttaaccaaagaggctgggagggatttgttgaattcttctgtgtagaggat
                        ************************************** ***********

A0A674IPL6_MCL1-01      ctagaaggt---agcatcaggaatgttctggtggcttttgcaggctttgc
A0A674JQC4_MCL1-01      ctagaaggtagcagcatcaggaatgttctggtggct---------tttgc
                        *********   ************************         *****

A0A674IPL6_MCL1-01      tggactgggagcaagcttggcctacatgatgcgatga
A0A674JQC4_MCL1-01      tggactgggagaatccttggcctacatgatgcaatga
                        *********** *  ***************** ****

© 1998-2023Legal notice