Dataset for CDS BAX of Organism Bos mutus grunniens

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9Y453_BAX-03      atggacgggtccggggagcaacccagaggcggggggcccaccag------
A0A8B9Y453_BAX-04      atggacgggtccggggagcaacccagaggcggggggcccaccag------
A0A8B9Y453_BAX-05      atggacgggtccggggagcaacccagaggcggggggcccaccag------
A0A8B9Y453_BAX-07      atggacgggtccggggagcaacccagaggcggggggcccaccag------
A0A8B9Y453_BAX-06      atggacgggtccggggagcaacccagaggcggggggcccaccag------
A0A8B9Y453_BAX-01      ----------------atgagctcccaga-------ttcgtcag------
A0A8B9Y453_BAX-02      -------ggttccccaagacgcccccagcccaagtttccctcagctgcgc
                                       *    * *  **          *  ***      

A0A8B9Y453_BAX-03      ----------ctctgagcagat----------------------------
A0A8B9Y453_BAX-04      ----------ctctgagcagat----------------------------
A0A8B9Y453_BAX-05      ----------ctctgagcagat----------------------------
A0A8B9Y453_BAX-07      ----------ctctgagcagat----------------------------
A0A8B9Y453_BAX-06      ----------ctctgagcagat----------------------------
A0A8B9Y453_BAX-01      -----aattattctaccgaggtggaggccgccgtcaaccgcc----tggt
A0A8B9Y453_BAX-02      acctcaggccctctgcgcacgcgctggccttctttgtccccttcgatagt
                                  ***    *                               

A0A8B9Y453_BAX-03      ---catgaagacagggg---------------------------------
A0A8B9Y453_BAX-04      ---catgaagacagggg---------------------------------
A0A8B9Y453_BAX-05      ---catgaagacagggg---------------------------------
A0A8B9Y453_BAX-07      ---catgaagacagggg---------------------------------
A0A8B9Y453_BAX-06      ---catgaagacagggg---------------------------------
A0A8B9Y453_BAX-01      taacatgca-actgcgg------------gcctcctacac----------
A0A8B9Y453_BAX-02      cagaaggcagagtccggttgcctggcctcgcctcctgcttaccattgttc
                           * * * *    **                                 

A0A8B9Y453_BAX-03      -----cccttttgcttcagggtttcatccaggatcgagcagggcgaatgg
A0A8B9Y453_BAX-04      -----cccttttgcttcagggtttcatccaggatcgagcagggcgaatgg
A0A8B9Y453_BAX-05      -----cccttttgcttcagggtttcatccaggatcgagcagggcgaatgg
A0A8B9Y453_BAX-07      -----cccttttgcttcagggtttcatccaggatcgagcagggcgaatgg
A0A8B9Y453_BAX-06      -----cccttttgcttcagg------------------------------
A0A8B9Y453_BAX-01      ---ctacctctctct---gggcttctatttcgaccgcg------------
A0A8B9Y453_BAX-02      ccgccatctcttcctgcagggcttctatttcgaccgcg------------
                              ** *  **   **                              

A0A8B9Y453_BAX-03      ggggagagacacccgagctgggcttggagcaggtgccccaggat------
A0A8B9Y453_BAX-04      ggggagagacacccgagctgggcttggagcaggtgccccaggat------
A0A8B9Y453_BAX-05      ggggagagacacccgagctgggcttggagcaggtgccccaggat------
A0A8B9Y453_BAX-07      ggggagagacacccgagctgggcttggagcaggtgccccaggat------
A0A8B9Y453_BAX-06      --------------------------------------------------
A0A8B9Y453_BAX-01      ------------acgatgtggccctggagggtgtgggtcacttttttcgc
A0A8B9Y453_BAX-02      ------------acgatgtggccctggagggtgtgggtcacttttttcgc
                                                                         

A0A8B9Y453_BAX-03      gcatccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaatt
A0A8B9Y453_BAX-04      gcatccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaatt
A0A8B9Y453_BAX-05      gcatccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaatt
A0A8B9Y453_BAX-07      gcatccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaatt
A0A8B9Y453_BAX-06      --------------------------------------------------
A0A8B9Y453_BAX-01      gaattggccaaggagaagcgcgagggcgcggagcgtctct----------
A0A8B9Y453_BAX-02      gaattggccaaggagaagcgcgagggcgcggagcgtctct----------
                                                                         

A0A8B9Y453_BAX-03      ggacagtaacatggagctgcagaggatgatcgcagctgtggacacagact
A0A8B9Y453_BAX-04      ggacagtaacatggagctgcagaggatgatcgcagctgtggacacagact
A0A8B9Y453_BAX-05      ggacagtaacatggagctgcagaggatgatcgcagctgtggacacagact
A0A8B9Y453_BAX-07      ggacagtaacatggagctgcagaggatgatcgcagctgtggacacagact
A0A8B9Y453_BAX-06      -----------------------ggatgatcgcagctgtggacacagact
A0A8B9Y453_BAX-01      -----------tgaaactgcaaa-----accagcgtggcggccgcgccct
A0A8B9Y453_BAX-02      -----------tgaaactgcaaa-----accagcgtggcggccgcgccct
                                                   * *   *  * ** * *   **

A0A8B9Y453_BAX-03      ctccccg----------agaggtctttttccgagtggcggctgaaatgtt
A0A8B9Y453_BAX-04      ctccccg----------agaggtctttttccgagtggcggctgaaatgtt
A0A8B9Y453_BAX-05      ctccccg----------agaggtctttttccgagtggcggctgaaatgtt
A0A8B9Y453_BAX-07      ctccccg----------agaggtctttttccgagtggcggctgaaatgtt
A0A8B9Y453_BAX-06      ctccccg----------agaggtctttttccgagtggcggctgaaatgtt
A0A8B9Y453_BAX-01      cttcctggacgtgcagaagccatctcaagatgagtgg-------------
A0A8B9Y453_BAX-02      cttcctggacgtgc---agccatctcaagatgagtgg-------------
                       ** ** *          **   ***      ******             

A0A8B9Y453_BAX-03      ttccgacggcaacttcaactggggccg----ggttgtcgcccttttctac
A0A8B9Y453_BAX-04      ttccgacggcaacttcaactggggccg----ggttgtcgcccttttctac
A0A8B9Y453_BAX-05      ttccgacggcaacttcaactggggccg----ggttgtcgcccttttctac
A0A8B9Y453_BAX-07      ttccgacggcaacttcaactggggccg----ggttgtcgcccttttctac
A0A8B9Y453_BAX-06      ttccgacggcaacttcaactggggccg----ggttgtcgcccttttctac
A0A8B9Y453_BAX-01      -------ggtaa----aacccaggacgctatggaggccgcccttctc---
A0A8B9Y453_BAX-02      -------ggtaa----aacccaggacgctatggaggccgcccttctc---
                              ** **    ***   ** **    **  * ******* **   

A0A8B9Y453_BAX-03      tttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagtt
A0A8B9Y453_BAX-04      tttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagtt
A0A8B9Y453_BAX-05      tttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagtt
A0A8B9Y453_BAX-07      tttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagtt
A0A8B9Y453_BAX-06      tttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagtt
A0A8B9Y453_BAX-01      ---------------gtagagaagaacc--tgaatcaa---gccctgttg
A0A8B9Y453_BAX-02      ---------------gtagagaagaacc--tgaatcaa---gccctgttg
                                      **    ***  **  ** * ***   ****   * 

A0A8B9Y453_BAX-03      gatcaggaccatcatgggctggacattg--------gacttcc---ttcg
A0A8B9Y453_BAX-04      gatcaggaccatcatgggctggacattg--------gacttcc---ttcg
A0A8B9Y453_BAX-05      gatcaggaccatcatgggctggacattg--------gacttcc---ttcg
A0A8B9Y453_BAX-07      gatcaggaccatcatgggctggacattg--------gacttcc---ttcg
A0A8B9Y453_BAX-06      gatcaggaccatcatgggctggacattg--------gacttcc---ttcg
A0A8B9Y453_BAX-01      gatctg------catggcctggcttctgcccgcggagacccccacatctg
A0A8B9Y453_BAX-02      gatctg------catggcctggcttctgcccgcggagacccccacatctg
                       **** *      ***** ****    **        ***  **   *  *

A0A8B9Y453_BAX-03      agagcggctgctgggctggatccaggaccagggtggttgg----------
A0A8B9Y453_BAX-04      agagcggctgctgggctggatccaggaccagggtggttgg----------
A0A8B9Y453_BAX-05      agagcggctgctgggctggatccaggaccagggtggttgggacggcctcc
A0A8B9Y453_BAX-07      agagcggctgctgggctggatccaggaccagggtggttgggacggcctcc
A0A8B9Y453_BAX-06      agagcggctgctgggctggatccaggaccagggtggttgggacggcctcc
A0A8B9Y453_BAX-01      tgacttcctggagaaccacttcctagatgagga-----------------
A0A8B9Y453_BAX-02      tgacttcctggagaaccacttcctagatgagga-----------------
                        **    ***  *  *    ***  **  ***                  

A0A8B9Y453_BAX-03      tcgcaaccttcggagtcagccactcagctgtc-cgcgatcaccgggacca
A0A8B9Y453_BAX-04      tcgcaaccttcggagtcagccactcagctgtc-cgcgatcaccgggacca
A0A8B9Y453_BAX-05      tctcctactttgg-gacacccacatggcagac-agtgaccatc-------
A0A8B9Y453_BAX-07      tctcctactttgg-gacacccacatggcagac-agtgaccatc-------
A0A8B9Y453_BAX-06      tctcctactttgg-gacacccacatggcagac-agtgaccatc-------
A0A8B9Y453_BAX-01      -----------agtgaaactcatcaagaagatgggtgaccacc-------
A0A8B9Y453_BAX-02      -----------agtgaaactcatcaagaagatgggtgaccacc-------
                                   * *  *  **    *  *    * ** ** *       

A0A8B9Y453_BAX-03      gccaccattttttaactccttattattaccgaccaatcatgagctcccag
A0A8B9Y453_BAX-04      gccaccattttttaactccttattattaccgaccaatcatgagctcccag
A0A8B9Y453_BAX-05      --------tttgtggc----------------------------------
A0A8B9Y453_BAX-07      --------tttgtggc----------------------------------
A0A8B9Y453_BAX-06      --------tttgtggc----------------------------------
A0A8B9Y453_BAX-01      ------------tgac----------------------------------
A0A8B9Y453_BAX-02      ------------tgac----------------------------------
                                   *  *                                  

A0A8B9Y453_BAX-03      attcgtcagaattattctaccgaggtggaggccgccgtcaaccgcctggt
A0A8B9Y453_BAX-04      attcgtcagaattattctaccgaggtggaggccgccgtcaaccgcctggt
A0A8B9Y453_BAX-05      -------------------------tggag-----tgctcaccgcctcgc
A0A8B9Y453_BAX-07      -------------------------tggag-----tgctcaccgcctcgc
A0A8B9Y453_BAX-06      -------------------------tggag-----tgctcaccgcctcgc
A0A8B9Y453_BAX-01      --------------------------------caacctccgcaggctggc
A0A8B9Y453_BAX-02      --------------------------------caacctccgcaggctggc
                                                                * * ** * 

A0A8B9Y453_BAX-03      taacatgcaactgcgggcctcctacacctacctctctctggtgaggttcc
A0A8B9Y453_BAX-04      taacatgcaactgcgggcctcctacacctacctctctctggtgaggttcc
A0A8B9Y453_BAX-05      t------------------------------caccatctgg---------
A0A8B9Y453_BAX-07      t------------------------------caccatctgg---------
A0A8B9Y453_BAX-06      t------------------------------caccatctgg---------
A0A8B9Y453_BAX-01      t------------------------------ggtccccaggctgggttgg
A0A8B9Y453_BAX-02      t------------------------------ggtccccaggctgggttgg
                       *                                    * **         

A0A8B9Y453_BAX-03      ccaagacgcccccagcccaagtttccctcagctgcgcacctcaggccctc
A0A8B9Y453_BAX-04      ccaagacgcccccagcccaagtttccctcagctgcgcacctcaggccctc
A0A8B9Y453_BAX-05      --aagaag------------------------------------------
A0A8B9Y453_BAX-07      --aagaag------------------------------------------
A0A8B9Y453_BAX-06      --aagaag------------------------------------------
A0A8B9Y453_BAX-01      gcgagtatctcttcgaaaggctcaccctcaagcacg--------------
A0A8B9Y453_BAX-02      gcgagtatctcttcgaaaggctcaccctcaagcacg--------------
                          **                                             

A0A8B9Y453_BAX-03      tgcgcacgcgctggccttctttgtccccttcgatag
A0A8B9Y453_BAX-04      tgcgcacgcgctggccttctttgtccccttcgatag
A0A8B9Y453_BAX-05      -----atgggctga----------------------
A0A8B9Y453_BAX-07      -----atgggctga----------------------
A0A8B9Y453_BAX-06      -----atgggctga----------------------
A0A8B9Y453_BAX-01      ---------actag----------------------
A0A8B9Y453_BAX-02      ---------actag----------------------
                                 **                        

© 1998-2023Legal notice