Dataset for CDS MCL-1 of organism Ictalurus punctatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2D0RCW7_MCL1-02      --------------------------------------------------
A0A2D0RCW7_MCL1-03      atgtgcgcccaattgaatgcggaaaacgggaacctctctatgatgtttag
A0A2D0RCW7_MCL1-01      ---------------------------------------------ttggg
                                                                          

A0A2D0RCW7_MCL1-02      ----atgga-------------------aactgcacagctggttaatccg
A0A2D0RCW7_MCL1-03      cccaaaggatttgtctctaaccgtgcctaacgtttcatctgggta-----
A0A2D0RCW7_MCL1-01      cccaaaggatttgtctctaaccgtgcctaacgtttcatctgggta-----
                            * ***                   ***    ** **** **     

A0A2D0RCW7_MCL1-02      ctaaaaacagc-----------------cctttctaggg-----------
A0A2D0RCW7_MCL1-03      caaagaaaagccactcgctgtcgtagctccttttcagagacccatattga
A0A2D0RCW7_MCL1-01      caaagaaaagccactcgctgtcgtagctccttttcagagacccatattga
                        * ** ** ***                 *****  ** *           

A0A2D0RCW7_MCL1-02      --------------caggaaacacattaaaatgtgcacga----------
A0A2D0RCW7_MCL1-03      atttaggaatttcttcggaaaaccagcgcggtttgtccgatggctcttta
A0A2D0RCW7_MCL1-01      atttaggaatttcttcggaaaaccagcgcggtttgtccgatggctcttta
                                        *****  **      * **  ***          

A0A2D0RCW7_MCL1-02      -----------caaggggtactaccaggaa--------------------
A0A2D0RCW7_MCL1-03      ccaacttcccccgaggtggactgcgacgaagttctaggcgtcggctgctt
A0A2D0RCW7_MCL1-01      ccaacttcccccgaggtggactgcgacgaagttctaggcgtcggctgctt
                                   * *** * *** * * ***                    

A0A2D0RCW7_MCL1-02      --------------------------------------------------
A0A2D0RCW7_MCL1-03      cctggagcacaacacgcgagagattatcgccgattttcttctgctcttca
A0A2D0RCW7_MCL1-01      cctggagcacaacacgcgagagattatcgccgattttcttctgctcttca
                                                                          

A0A2D0RCW7_MCL1-02      -------------------------------cagggttt-----------
A0A2D0RCW7_MCL1-03      cgtcgccgtctcgccctttggggcgacatcgtaaggttttacagacgatg
A0A2D0RCW7_MCL1-01      cgtcgccgtctcgccctttggggcgacatcgtaaggttttacagacgatg
                                                        * *****           

A0A2D0RCW7_MCL1-02      ------------------------------------------------gg
A0A2D0RCW7_MCL1-03      aagtgcgttgtagacggcttgttggtgaagcacgaacttgtatataaagg
A0A2D0RCW7_MCL1-01      aagtgcgttgtagacggcttgttggtgaagcacgaacttgtatataaagg
                                                                        **

A0A2D0RCW7_MCL1-02      aatgcttgcaaagctgtgcttggacgagagaggagatgacatgagtgtga
A0A2D0RCW7_MCL1-03      aatgcttgcaaagctgtgcttggacgagagaggagatgacatgagtgtga
A0A2D0RCW7_MCL1-01      aatgcttgcaaagctgtgcttggacgagagaggagatgacatgagtgtga
                        **************************************************

A0A2D0RCW7_MCL1-02      ttagttcagtggctacagagctcttcagcgatggagtcacaaactggggt
A0A2D0RCW7_MCL1-03      ttagttcagtggctacagagctcttcagcgatggagtcacaaactggggt
A0A2D0RCW7_MCL1-01      ttagttcagtggctacagagctcttcagcgatggagtcacaaactggggt
                        **************************************************

A0A2D0RCW7_MCL1-02      cgcattgccagcctgctggcttttggagcagttgtgtctaaatatgagat
A0A2D0RCW7_MCL1-03      cgcattgccagcctgctggcttttggagcagttgtgtctaaatatgagat
A0A2D0RCW7_MCL1-01      cgcattgccagcctgctggcttttggagcagttgtgtctaaatatgagat
                        **************************************************

A0A2D0RCW7_MCL1-02      ggagtctggacgagggcactgtccaagcatcgtggcagaagagatctcat
A0A2D0RCW7_MCL1-03      ggagtctggacgagggcactgtccaagcatcgtggcagaagagatctcat
A0A2D0RCW7_MCL1-01      ggagtctggacgagggcactgtccaagcatcgtggcagaagagatctcat
                        **************************************************

A0A2D0RCW7_MCL1-02      catatctcctgtttaatcaaaaggagtggcttctgaaaaacaactcgtgg
A0A2D0RCW7_MCL1-03      catatctcctgtttaatcaaaaggagtggcttctgaaaaacaactcgtgg
A0A2D0RCW7_MCL1-01      catatctcctgtttaatcaaaaggagtggcttctgaaaaacaactcgtgg
                        **************************************************

A0A2D0RCW7_MCL1-02      gatggctttgtggaattttttcacgttcctgatccagaatcttcagtgag
A0A2D0RCW7_MCL1-03      gatggctttgtggaattttttcacgttcctgatccagaatcttcagtgag
A0A2D0RCW7_MCL1-01      gatggctttgtggaattttttcacgttcctgatccagaatcttcagtgag
                        **************************************************

A0A2D0RCW7_MCL1-02      gtccgcattaacgaccattgttactgtggcaggcattggggctgttcttg
A0A2D0RCW7_MCL1-03      gtccgcattaacgaccattgttactgtggcaggcattggggctgttcttg
A0A2D0RCW7_MCL1-01      gtccgcattaacgaccattgttactgtggcaggcattggggctgttcttg
                        **************************************************

A0A2D0RCW7_MCL1-02      cctacttgacaagatga
A0A2D0RCW7_MCL1-03      cctacttgacaagatga
A0A2D0RCW7_MCL1-01      cctacttgacaagatga
                        *****************

© 1998-2020Legal notice