Dataset for CDS BOK of Organism Amazona collaria

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8B9IV47_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Amazona collaria GN=BOK (length=591 residues).
atgtggaggtctcccactgacaaggagcttgtgtcccaggccaaggctctctgcagagactacatcaattccaggctaat
tcgagcaggtgtcagctggagcaaacctgagtacaatgcaccagtgcctggcggtaagctagccgaggtgtccgccatac
tgctgcgactgggggatgagctggaatacattcgccccaatgtctaccggaatatcgcccgccaactgaacatctccctg
cactcggagacggtggtgacagatgccttcctggcagtggcagcacagattttcactgcaggcataacgtggggcaaggt
ggtgtctctctatgctgtggcagctgggctgtcagtggactgtgtgcggcacgcacagccagccatggttcacactatcg
tagactgcctgggagagtttgtccgcaagaccttggtaacatggctgaaaaggagaggaggctgggcagacatcacaaaa
tgcgtggtgaacactgaccccagcctccgctcccactggctcgtgtctgctgtttgcagctttggtcacttcctcaaggc
tatcttcttcgtcctgctgcctgagagatga
© 1998-2023Legal notice