Dataset for CDS MCL-1 of organism Xiphophorus maculatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B5PQ55_MCL1-01      atgacagctaattcgacaaacgcgttaaactatctcattttttctcaaaa
A0A3B5PQ55_MCL1-02      atgacagctaattcgacaaacgcgttaaactatctcattttttctcaaaa

A0A3B5PQ55_MCL1-01      tggagtcgggaatggacaaacacactacgaccagggactcggtgtgcctg
A0A3B5PQ55_MCL1-02      tggagtcgggaatggacaaacacactacgaccagggactcggtgtgcctg

A0A3B5PQ55_MCL1-01      aggtcgcaatgggctccactgtagaatctcttcattcgcctaaggatccc
A0A3B5PQ55_MCL1-02      aggtcgcaatgggctccactgtagaatctcttcattcgcctaaggatccc

A0A3B5PQ55_MCL1-01      ttcatgaaacgcccgacgaatctcggagtgaatggatatgttgcgaaaag
A0A3B5PQ55_MCL1-02      ttcatgaaacgcccgacgaatctcggagtgaatggatatgttgcgaaaag

A0A3B5PQ55_MCL1-01      ccttccgacgagcagcgacgacagcgacgaaggctctctgccatgcaccc
A0A3B5PQ55_MCL1-02      ccttccgacgagcagcgacgacagcgacgaaggctctctgccatgcaccc

A0A3B5PQ55_MCL1-01      cggcgcagcacccagacagtgaaaaagacgcgacggccgtaggtgcgagc
A0A3B5PQ55_MCL1-02      cggcgcagcacccagacagtgaaaaagacgcgacggccgtaggtgcgagc

A0A3B5PQ55_MCL1-01      aaccaagtgctggataacgacacaacggagcttattagcagttttctgag
A0A3B5PQ55_MCL1-02      aaccaagtgctggataacgacacaacggagcttattagcagttttctgag

A0A3B5PQ55_MCL1-01      agactttacgggactttcaaagtgtcggtggggtcaaaataaagctctat
A0A3B5PQ55_MCL1-02      agactttacgggactttcaaagtgtcggtggggtcaaaataaagctctat

A0A3B5PQ55_MCL1-01      ctacgatgaaaagggtggtggaggaccttttgtcgaagcacaagtatgca
A0A3B5PQ55_MCL1-02      ctacgatgaaaagggtggtggaggaccttttgtcgaagcacaagtatgca

A0A3B5PQ55_MCL1-01      tacaatggtatggtcaataggcttgctctggataacgagccggacgacat
A0A3B5PQ55_MCL1-02      tacaatggtatggtcaataggcttgctctggataacgagccggacgacat

A0A3B5PQ55_MCL1-01      ggagtttgttacggaaatagcagagagtctcttttcagacgggatcacca
A0A3B5PQ55_MCL1-02      ggagtttgttacggaaatagcagagagtctcttttcagacgggatcacca

A0A3B5PQ55_MCL1-01      actggggtcggatcgccagcctggtgacgttcggggctgcggtgtgtcag
A0A3B5PQ55_MCL1-02      actggggtcggatcgccagcctggtgacgttcggggctgcggtgtgtcag

A0A3B5PQ55_MCL1-01      cgcctgaaggagaggggcagagagcactgcgtggagctggtgagccggaa
A0A3B5PQ55_MCL1-02      cgcctgaaggagaggggcagagagcactgcgtggagctggtgagccggaa

A0A3B5PQ55_MCL1-01      aatatccacgtatctcctggcaaaccagcgggactggctagcaaaaaaca
A0A3B5PQ55_MCL1-02      aatatccacgtatctcctggcaaaccagcgggactggctagcaaaaaaca

A0A3B5PQ55_MCL1-01      actcatgggagggctttgtggagttctttagagtatcggacccggagtct
A0A3B5PQ55_MCL1-02      actcatgggagggctttgtggagttctttagagtatcggacccggagtct

A0A3B5PQ55_MCL1-01      acagtgaggaacacgctgatggctgttgtgggggtcgctggtattggggc
A0A3B5PQ55_MCL1-02      acagtgaggaacacgctgatggctgttgtgggggtcgctggtattggggc

A0A3B5PQ55_MCL1-01      caccttagcctttcttatcaggagatgcaaagagaagtattga
A0A3B5PQ55_MCL1-02      caccttagcctttcttatcag---------------cttctga
                        *********************                *  ***

© 1998-2020Legal notice