Dataset for CDS MCL-1 of organism Otolemur garnettii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

H0XFB7_MCL1-01      atgtttggcctcaagagaaacgcagtgatcggactcaacctctactgtgggggcgccggg
H0XHA5_MCL1-01      ------------------------------------------------------------

H0XFB7_MCL1-01      ctgggggctggcagcggcggcgccacacccccgggagggcggcttttggctgcggagaag
H0XHA5_MCL1-01      ------------------------------------------------------------

H0XFB7_MCL1-01      gaggccgcggcccggcgagaggcagggggaggggaagccggcgaggtgattggcggaagc
H0XHA5_MCL1-01      ------------------------------------------------------------

H0XFB7_MCL1-01      cccggcgcgagttccccggcctccctcacgccagacgcccggagggtcgcgcggccgccg
H0XHA5_MCL1-01      ------------------------------------------------------------

H0XFB7_MCL1-01      cccattggtgccgaagtccccgacgtcaccgcgacccccacgaggctgctgttcttcgcg
H0XHA5_MCL1-01      -------------------------------------ctaccagacc-------------
                                                         * ** ** *              

H0XFB7_MCL1-01      cccaccctccgtgcggcgccgcgggaggagatggaagcccctgccgccgacgccatcatg
H0XHA5_MCL1-01      ----------------------------agatggaagcccaagttgccgatgccgtcaag
                                                ************  *  ***** *** *** *

H0XFB7_MCL1-01      tcgccggaagatgagctggacgggtacgagccggagcctttggggaagcggccggcggtc
H0XHA5_MCL1-01      tcgcccgaaggtgaggtggcctcgtgcgagccggagcctctcaagaagcaaccggagggc
                    ***** **** **** *** *  ** ************* *   *****  **** ** *

H0XFB7_MCL1-01      ctgcctttgctggagttggtcggggaggccagtaacggccccagcactgatgggtcactt
H0XHA5_MCL1-01      ctgcctttgctggagtttgttggtgaggccggtaacggccccagcactgaca---cactt
                    ***************** ** ** ****** *******************     *****

H0XFB7_MCL1-01      ccttcgacaccgcccccagcagaggaggaggaggatgagttataccggcagtcgctggag
H0XHA5_MCL1-01      ccttccacacctcccccagca---gaggaggaggatgagttatactggcagtcgatggag
                    ***** ***** *********   ********************* ******** *****

H0XFB7_MCL1-01      atcatctctcggtaccttcgggagcaggcgaccggtgccaaggacgcgaaaccaatgggc
H0XHA5_MCL1-01      atcatctctcggtacctatgggagca----------------------------------
                    *****************  *******                                  

H0XFB7_MCL1-01      agggcaggagccgccagcaggaaggcgctggagaccttgcgccgcgttggggacggggtg
H0XHA5_MCL1-01      ------------------------------------------------------------

H0XFB7_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
H0XHA5_MCL1-01      -------------------------------------ggaaactgg-------------a
                                                         *********             *

H0XFB7_MCL1-01      gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaac
H0XHA5_MCL1-01      gaggatatcaactctttgtctcgagtgatggcccatgttttcagttacggcgtaacaaat
                    ** *** **** ******************* ************* ************* 

H0XFB7_MCL1-01      tggggcaggattgtgactctaatttcttttggtgcctttgtggccaaacacttgaagagc
H0XHA5_MCL1-01      tggggcaggattatgaccctaat---ttttggtggctttgtggccaagcacctgaagacc
                    ************ **** *****   ******** ************ *** ****** *

H0XFB7_MCL1-01      ataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttcttgtaagg
H0XHA5_MCL1-01      ataaaccaagaaggctacatcaaaccgctagaagaaaatatcgcagatgtccttgtgagg
                    ************ *** **** ****  *** ***** **** **** ** ***** ***

H0XFB7_MCL1-01      acaaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
H0XHA5_MCL1-01      acaaaaccggactggctagtcaaacaacgaggctgggatggctttgtggagttcttctac
                    ******* ******************* ************* *************** * 

H0XFB7_MCL1-01      gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgctgga
H0XHA5_MCL1-01      ctggaagacctggaaagcagcgtcagaaacgtgctgctggctttcgcaggtgttgctgga
                     * ** ***** *** ** ** ******* ************** ** ************

H0XFB7_MCL1-01      gtaggagctggtttggcatatctaataagatag
H0XHA5_MCL1-01      gtaggagctggcttgacctatctaataagatag
                    *********** *** * ***************

© 1998-2021Legal notice