Dataset for CDS BAX of Organism Haplochromis burtoni

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q2VJY7_BAX-01      ------------------gcaata--------------------------
A0A3Q2VJY7_BAX-02      tactcggacttttacaccatgaccgctgctgtgatttggt----------
A0A3Q2VJY7_BAX-03      ------------------atgacc--------------------------
A0A3Q3C2Q2_BAX-01      --------------------------------------------------
A0A3Q3CU65_BAX-01      ------------------acccc---------------------------
A0A3Q2V329_BAX-01      ------------------atggcatcacacccgggaggaggcgatcaagg
A0A3Q2V329_BAX-02      ------------------atg-----------------------------
                                                                         

A0A3Q2VJY7_BAX-01      ---tgcaaaacatgcaa-gaagagaatcacag----acagagat------
A0A3Q2VJY7_BAX-02      -gttgtttgaagtttactgaggagaatctttgtataataaaatt------
A0A3Q2VJY7_BAX-03      ---tgctctacttcctgtgatgcaaatctttgtataataaaatt------
A0A3Q3C2Q2_BAX-01      --------------------------------------------------
A0A3Q3CU65_BAX-01      -catgtc--cccctgcatgccacggggtcctggttggcccaacttgccct
A0A3Q2V329_BAX-01      tagtggcagctatcgtcaacaaataaaatacatatatttcgact------
A0A3Q2V329_BAX-02      -agtgtctacctttgtctttcagggaattccggaga-tcagata------
                                                                         

A0A3Q2VJY7_BAX-01      ------------ggaacaacttccaactttgtccgacagttgaagactgt
A0A3Q2VJY7_BAX-02      ------------gtgggtgttttt--ttttgtctg---------------
A0A3Q2VJY7_BAX-03      ------------gtgggtgttttt--ttttgtctg---------------
A0A3Q3C2Q2_BAX-01      ---------------atggcttac--tgttgtgta---------------
A0A3Q3CU65_BAX-01      ctttacctggcagtcctcggctgc--cctcgggtc---------------
A0A3Q2V329_BAX-01      ------ctgacagt-atggcttac--tgttgtgta---------------
A0A3Q2V329_BAX-02      ------ctggaagt-cggaacta---------------------------
                                            *                            

A0A3Q2VJY7_BAX-01      ctttatgtatgtgattgcacatataaacacagaggagcccagtc-----g
A0A3Q2VJY7_BAX-02      ctacaggtatgtgattgcacatataaacacagaggagcccagtc-----g
A0A3Q2VJY7_BAX-03      ctacaggtatgtgattgcacatataaacacagaggagcccagtc-----g
A0A3Q3C2Q2_BAX-01      tttgtgctgtatagtttcatctatgagc------gagttcagaggcaaag
A0A3Q3CU65_BAX-01      ctttatttcccgtctctcct-----------------------------g
A0A3Q2V329_BAX-01      tttgtgctgtatagtttcatctatgagc------gagttcagaggcaagg
A0A3Q2V329_BAX-02      -ttttgttacaggatttcatctatgagc------gagttcagaggcaagg
                        *     *      *  *                               *

A0A3Q2VJY7_BAX-01      acacgtgacttctgaggatttgggaggaaggccagatgaacaacag----
A0A3Q2VJY7_BAX-02      acacgtgacttctgaggatttgggaggaaggccagatgaacaacag----
A0A3Q2VJY7_BAX-03      acacgtgacttctgaggatttgggaggaaggccagatgaacaacag----
A0A3Q3C2Q2_BAX-01      agatggcaatagggcagtgacgagagaacagcttgatggaagccagctga
A0A3Q3CU65_BAX-01      atatgactttaa-------------------------------------a
A0A3Q2V329_BAX-01      agatggcaataatgcagtgacgagagaacagcttggtggaagccagctga
A0A3Q2V329_BAX-02      agatggcaataatgcagtgacgagagaacagcttggtggaagccagctga
                       * * *    *                                        

A0A3Q2VJY7_BAX-01      --gatccacaagtcaaagaagtggtagaacagctgcgcaagatagccgac
A0A3Q2VJY7_BAX-02      --gatccacaagtcaaagaagtggtagaacagctgcgcaagatagccgac
A0A3Q2VJY7_BAX-03      --gatccacaagtcaaagaagtggtagaacagctgcgcaagatagccgac
A0A3Q3C2Q2_BAX-01      ctgacccaaaacataagaagcttgctcagtgcctgcagcatattggagac
A0A3Q3CU65_BAX-01      tggacct---gcattaaaagtccatttaatgc------------------
A0A3Q2V329_BAX-01      ctgacccaaaacataagaagcttgctcagtgcctgcagcagattggagat
A0A3Q2V329_BAX-02      ctgacccaaaacataagaagcttgctcagtgcctgcagcagattggagat
                         ** *         *  *        *                      

A0A3Q2VJY7_BAX-01      agtttaaaccgcaatgctgagcttcagagactgataaaccaggttcaggg
A0A3Q2VJY7_BAX-02      agtttaaaccgcaatgctgagcttcagagactgataaaccaggttcaggg
A0A3Q2VJY7_BAX-03      agtttaaaccgcaatgctgagcttcagagactgataaaccaggttcaggg
A0A3Q3C2Q2_BAX-01      gagctggatggaaatgtagagctccaaagaatgataaataactcttcg--
A0A3Q3CU65_BAX-01      -------------------aggtccaaagaatgataaatgactcttcg--
A0A3Q2V329_BAX-01      gagctggatggaaatgtagagctccaaagaatgataaatgactcttcg--
A0A3Q2V329_BAX-02      gagctggatggaaatgtagagctccaaagaatgataaatgactcttcg--
                                          ** * ** *** *******  *   *  *  

A0A3Q2VJY7_BAX-01      gaactgcgttc-----aagatgtcttcatggcagttgcaagaaacatctt
A0A3Q2VJY7_BAX-02      gaactgcgttc-----aagatgtcttcatggcagttgcaagaaacatctt
A0A3Q2VJY7_BAX-03      gaactgcgttc-----aagatgtcttcatggcagttgcaagaaacatctt
A0A3Q3C2Q2_BAX-01      ---ctttgtcccacaagaaaggtttttatgagagtggcctctgagatctt
A0A3Q3CU65_BAX-01      ---ctttgtcccacaagagaggtttttatgagagtggcctatgagatctt
A0A3Q2V329_BAX-01      ---ctttgtcccacaagagaggtttttatgagagtggcctatgagatctt
A0A3Q2V329_BAX-02      ---ctttgtcccacaagagaggtttttatgagagtggcctatgagatctt
                          **  ** *      * * ** ** ***  *** **     * *****

A0A3Q2VJY7_BAX-01      tgctgatggca---tcaactggggtcgagtagtggctctcttccatctgg
A0A3Q2VJY7_BAX-02      tgctgatggca---tcaactggggtcgagtagtggctctcttccatctgg
A0A3Q2VJY7_BAX-03      tgctgatggca---tcaactggggtcgagtagtggctctcttccatctgg
A0A3Q3C2Q2_BAX-01      ttcagatggaatatttaactggggcagggtggttgcactgttctactttg
A0A3Q3CU65_BAX-01      ttcagatggaatatttaactggggcagggaggttgcactgttctactttg
A0A3Q2V329_BAX-01      ttcagatggaatatttaactggggcagggaggttgcactgttctactttg
A0A3Q2V329_BAX-02      ttcagatggaatatttaactggggcagggaggttgcactgttctactttg
                       * * ***** *   * ********  * *  ** ** ** *** *  * *

A0A3Q2VJY7_BAX-01      cctgtaaacttatacacaaggctattaccgccaatcacttagagaacatc
A0A3Q2VJY7_BAX-02      cctgtaaacttatacacaaggctattaccgccaatcacttagagaacatc
A0A3Q2VJY7_BAX-03      cctgtaaacttatacacaaggctattaccgccaatcacttagagaacatc
A0A3Q3C2Q2_BAX-01      catgccgactcgttatcaaagtacgtgaaactgctattgccgattccccc
A0A3Q3CU65_BAX-01      catgccgactcgttatcaaagctcttgtaactcagattccggatattatc
A0A3Q2V329_BAX-01      catgccgactcgttatcaaagctcttgtaactcagattccggatattatc
A0A3Q2V329_BAX-02      catgccgactcgttatcaaagctcttgtaactcagattccggatattatc
                       * **   ***  *   *** *    *    *          **      *

A0A3Q2VJY7_BAX-01      caaatga--tcatcagctgggtcctccaggtcatcagggagcaggtctac
A0A3Q2VJY7_BAX-02      caaatga--tcatcagctgggtcctccaggtcatcagggagcaggtctac
A0A3Q2VJY7_BAX-03      caaatga--tcatcagctgggtcctccaggtcatcagggagcaggtctac
A0A3Q3C2Q2_BAX-01      gttactaccctgttggtcacttcatgttttgttttc--------------
A0A3Q3CU65_BAX-01      agaacca--ttatcagttggaccatagactatctccgggaacatgtgatc
A0A3Q2V329_BAX-01      agaacca--ttatcagttggaccatagactatctccgggaacatgtgatc
A0A3Q2V329_BAX-02      agaacca--ttatcagttggaccatagactatctccgggaacatgtgatc
                          *  *     *  *      * *        *                

A0A3Q2VJY7_BAX-01      agctggcttgtggcacaagggggctgggagggggtgatccgtggtttctc
A0A3Q2VJY7_BAX-02      agctggcttgtggcacaagggggctgggagggggtgatccgtggtttctc
A0A3Q2VJY7_BAX-03      agctggcttgtggcacaagggggctgggagggggtgatccgtggtttctc
A0A3Q3C2Q2_BAX-01      ----ataccagcaataaagct------gagg---------tttttgagtt
A0A3Q3CU65_BAX-01      aactggatcagggagcaaggtggctgggagg---------gtattcgctc
A0A3Q2V329_BAX-01      aactggatcagggagcaaggtggctgggagg---------gtattcgctc
A0A3Q2V329_BAX-02      aactggatcagggagcaaggtggctgggagg---------gtattcgctc
                                       ***        ****          *  *   * 

A0A3Q2VJY7_BAX-01      tcgatggaggacagcagccatggta----gcatcagtagtattggtggta
A0A3Q2VJY7_BAX-02      tcgatggaggacagcagccatggta----gcatcagtagtattggtggta
A0A3Q2VJY7_BAX-03      tcgatggaggacagcagccatggta----gcatcagtagtattggtggta
A0A3Q3C2Q2_BAX-01      tcacgttagt-------------------gtctgag--tcctgcgtttgg
A0A3Q3CU65_BAX-01      ctactttggcacaccaa-catggcagacggtcgaagttttcttggcagga
A0A3Q2V329_BAX-01      ctactttggcacaccaa-catggcagacggtcggagttttcttggcagga
A0A3Q2V329_BAX-02      ctactttggcacaccaa-catggcagacggtcggagttttcttggcagga
                               *                    *    **     *  *     

A0A3Q2VJY7_BAX-01      gcctt--------tgtttactac-cgga-----aagtacgataa
A0A3Q2VJY7_BAX-02      gcctt--------tgtttactac-cgga-----aagtacgataa
A0A3Q2VJY7_BAX-03      gcctt--------tgtttactac-cgga-----aagtacgataa
A0A3Q3C2Q2_BAX-01      atcct--cctctccgcctgcc---cgcacacagagccctga---
A0A3Q3CU65_BAX-01      gtccttaccactgttcttgtcattcgca-----agatgtga---
A0A3Q2V329_BAX-01      gtccttaccactgttcttgtcattcgca-----agatgtga---
A0A3Q2V329_BAX-02      gtccttaccactgttcttgtcattcgca-----agatgtga---
                         * *            *      ** *     *     **   

© 1998-2023Legal notice