Dataset for CDS BAX of Organism Cercocebus atys

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5KU58_BAX-03      atggacgggtccggggagcagcccagaggcgggggtgaggcggg----ag
A0A2K5KU58_BAX-04      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
                       ***********************************     *  *      

A0A2K5KU58_BAX-03      gcagac-----gggcgggag------------gaggtttcatccaggatc
A0A2K5KU58_BAX-04      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
                       *****       * * ** *              ****************

A0A2K5KU58_BAX-03      gagcagggcgaatggggggggagacacccgagctggccctggacccggtg
A0A2K5KU58_BAX-04      gagcagggcgaatggggggggagacacccgagctggccctggacccggtg
                       **************************************************

A0A2K5KU58_BAX-03      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg
A0A2K5KU58_BAX-04      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg
                       **************************************************

A0A2K5KU58_BAX-03      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2K5KU58_BAX-04      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
                       **************************************************

A0A2K5KU58_BAX-03      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2K5KU58_BAX-04      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
                       **************************************************

A0A2K5KU58_BAX-03      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2K5KU58_BAX-04      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
                       **************************************************

A0A2K5KU58_BAX-03      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2K5KU58_BAX-04      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
                       **************************************************

A0A2K5KU58_BAX-03      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc
A0A2K5KU58_BAX-04      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc
                       **************************************************

A0A2K5KU58_BAX-03      tggatccaagaccagggtggttgggacggcctcct--gtcctactttggg
A0A2K5KU58_BAX-04      tggatccaagaccagggtggttgggtgagactcctcaaccctccc-----
                       *************************   * *****    *** *      

A0A2K5KU58_BAX-03      acacccacgtggcagaccgtgaccatcttggtggctggagtactcaccgc
A0A2K5KU58_BAX-04      -caccccaaccaccgcccctgccccact--gtccctg-----cccacccc
                        *****      * * ** ** **  **  **  ***     * **** *

A0A2K5KU58_BAX-03      ct--------------ccctcaccatc--tgga--agaagatggg-----
A0A2K5KU58_BAX-04      ctgtcacagtggtgccctctccccatctttggatcatcagatgtggtcta
                       **              * *** *****  ****  *  ***** *     

A0A2K5KU58_BAX-03      -----------ctga-------
A0A2K5KU58_BAX-04      taatgcatttccttatgtgtct
                                  ** *       

© 1998-2020Legal notice