Dataset for CDS BCL2L1 of organism Oncorhynchus kisutch

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C7FX38_BCL2L1-      ---atgtcttacagtaacagg---gaactggtagtgttttttataagcta
A0A8C7CBC7_BCL2L1-      ---atgtcttacagtaacagg---gaactggtggtgttttttataagcta
A0A8C7CBC7_BCL2L1-      ---atgtcttacagtaacagg---gaactggtggtgttttttataagcta
A0A8C7J9N8_BCL2L1-      atgatgacttacaacaacaga---gaactggtggtatactatatcaccta
A0A8C7IJ10_BCL2L1-      ------atgtgtattaacctacctgaactggtggtatactatattaccta
A0A8C7IJ10_BCL2L1-      attatgacttacaacaacaga---gaactggtggtatactatattaccta
                                 *  *  ***      ******** ** *  * *** * ***

A0A8C7FX38_BCL2L1-      tagactgtcccagaggaattattcatgttgtcaattggggctggagggtg
A0A8C7CBC7_BCL2L1-      taaactgtcccagagaaattatccatgttgtcagttggtgctggagggtg
A0A8C7CBC7_BCL2L1-      taaactgtcccagagaaattatccatgttgtcagttggtgctggagggtg
A0A8C7J9N8_BCL2L1-      taaactatcacagagggactaccccttcaaccacatggagctcacagaag
A0A8C7IJ10_BCL2L1-      taaactatcacagagagactaccccttcaaccacattgggctcacagaag
A0A8C7IJ10_BCL2L1-      taaactatcacagagagactaccccttcaaccacattgggctcacagaag
                        ** *** ** *****  * **  * *     **  * * ***    *  *

A0A8C7FX38_BCL2L1-      caagtggacggactgagggagatgaggccattgcaaatgggtctgtgggg
A0A8C7CBC7_BCL2L1-      caagtggacggactgagggggatgaagccattgcaaatgggtctttgggg
A0A8C7CBC7_BCL2L1-      caagtggacggactgagggggatgaagccattgcaaatgggtctttgggg
A0A8C7J9N8_BCL2L1-      cccagaatcggactgagggggg----------gcaggtgga---aggggg
A0A8C7IJ10_BCL2L1-      ctcccagtcggactgagggggg----------acaggtgga---aggggg
A0A8C7IJ10_BCL2L1-      ctcccagtcggactgagggggg----------acaggtgga---aggggg
                        *       *********** *            **  ***      ****

A0A8C7FX38_BCL2L1-      aactactggaacagca----------------------gaagcaatttgg
A0A8C7CBC7_BCL2L1-      aacaacaggaacggca----------------------gaagcaatttgg
A0A8C7CBC7_BCL2L1-      aacaacaggaacggca----------------------gaagcaatttgg
A0A8C7J9N8_BCL2L1-      tgcggcagtcatgacatac------------gtcaacgggacgagtcccg
A0A8C7IJ10_BCL2L1-      ggcggcagtcacgacacaccccaatggcacagtgaacgggacgagtcctg
A0A8C7IJ10_BCL2L1-      ggcggcagtcacgacacaccccaatggcacagtgaacgggacgagtcctg
                          *  * *  *   **                      * *  * *   *

A0A8C7FX38_BCL2L1-      cga---------------------agccctcatctccacaggg------g
A0A8C7CBC7_BCL2L1-      gta---------------------tgccttcctctgcacaagg------g
A0A8C7CBC7_BCL2L1-      gta---------------------tgccttcctctgcacaagg------g
A0A8C7J9N8_BCL2L1-      gtactcctccaccacggcagtcgcccccctcctcccctcggcggacagcg
A0A8C7IJ10_BCL2L1-      gga---ctccaccgcgacagtctcccccctcgtcccctcagcggacaatg
A0A8C7IJ10_BCL2L1-      gga---ctccaccgcgacagtctcccccctcgtcccctcagcggacaatg
                          *                       ** ** **  * *   *      *

A0A8C7FX38_BCL2L1-      ggcatggagccagtgaaagcagcactacgggactcagtggatgagtttga
A0A8C7CBC7_BCL2L1-      ggaattgaggcggtgaaagcagcactacgggactcagtggatgagtttga
A0A8C7CBC7_BCL2L1-      ggaattgaggcggtgaaagcagcactacgggactcagtggatgagtttga
A0A8C7J9N8_BCL2L1-      ggcctggacgcagtgaaagaggcattgcgggactctgccaacgagtttga
A0A8C7IJ10_BCL2L1-      ggcctggacgcagtgaaagaggcattgcgggactctgccaacgagtttga
A0A8C7IJ10_BCL2L1-      ggcctggacgcagtgaaagaggcattgcgggactctgccaacgagtttga
                        **  * **  * *******  *** * ******** *   * ********

A0A8C7FX38_BCL2L1-      gctgcgctacacccgcgccttcagtgacctctcctcccagctccacatca
A0A8C7CBC7_BCL2L1-      gctgcgttacacccgtgccttcagtgacctctgctcccagctccacatca
A0A8C7CBC7_BCL2L1-      gctgcgttacacccgtgccttcagtgacctctgctcccagctccacatca
A0A8C7J9N8_BCL2L1-      gctgcgttatgccagagctttcagtgacctgtcctcccagctacacatca
A0A8C7IJ10_BCL2L1-      gctgcgttatgccagagcgttcagtgacctgtcctcccagctacacatca
A0A8C7IJ10_BCL2L1-      gctgcgttatgccagagcgttcagtgacctgtcctcccagctacacatca
                        ****** **  ** * ** *********** * ********* *******

A0A8C7FX38_BCL2L1-      cccctgccacagcctaccacagctttgagagtgtgatggacgaagtgttc
A0A8C7CBC7_BCL2L1-      cccctgccacagcctaccacagctttgagagcgtgatggacgaagtgttc
A0A8C7CBC7_BCL2L1-      cccctgccacagcctaccacagctttgagagcgtgatggacgaagtgttc
A0A8C7J9N8_BCL2L1-      cgccgtccacagcctatcagagctttgagaacgtgatggacgaggtgttc
A0A8C7IJ10_BCL2L1-      cgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttc
A0A8C7IJ10_BCL2L1-      cgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttc
                        * **  ********** ** ***** ****  ******** ** ** ***

A0A8C7FX38_BCL2L1-      agggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggtgg
A0A8C7CBC7_BCL2L1-      agggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcgg
A0A8C7CBC7_BCL2L1-      agggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcgg
A0A8C7J9N8_BCL2L1-      cgggacggtgtcaactggggacgggtggtgggcctgtttgctttcggagg
A0A8C7IJ10_BCL2L1-      cgtgacggtgtgaactggggacgtgtggtgggcctgtttgccttcggagg
A0A8C7IJ10_BCL2L1-      cgtgacggtgtgaactggggacgtgtggtgggcctgtttgccttcggagg
                         * ***** ** ******** ** ******** ******** ** ** **

A0A8C7FX38_BCL2L1-      ggccttgtgtgttgagtgtgttgagaaggatatgagcccactggtggcgc
A0A8C7CBC7_BCL2L1-      ggccctgtgcgttgagtgtgttgagaaggatatgagccacctggtgacgc
A0A8C7CBC7_BCL2L1-      ggccctgtgcgttgagtgtgttgagaaggatatgagccacctggtgacgc
A0A8C7J9N8_BCL2L1-      ggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaa
A0A8C7IJ10_BCL2L1-      ggccctctgtgtagagtgtgtggagaaggagatgagcccactagtgggac
A0A8C7IJ10_BCL2L1-      ggccctctgtgtagagtgtgtggagaaggagatgagcccactagtgggac
                        **** * ** ** ** ***** ** ***** **** **   * ***    

A0A8C7FX38_BCL2L1-      gcatcgcagattggatgaccacatacctggacaaccatatccagccctgg
A0A8C7CBC7_BCL2L1-      gcatcgcagactggatggccacctacctggacaaccatatccagccctgg
A0A8C7CBC7_BCL2L1-      gcatcgcagactggatggccacctacctggacaaccatatccagccctgg
A0A8C7J9N8_BCL2L1-      ggatcacagactggatgaccgtctatctggacaaccacatccagccctgg
A0A8C7IJ10_BCL2L1-      ggattgcagactggatgactgtatacctggacaaccacattcagccctgg
A0A8C7IJ10_BCL2L1-      ggattgcagactggatgactgtatacctggacaaccacattcagccctgg
                        * **  **** ****** *    ** *********** ** *********

A0A8C7FX38_BCL2L1-      atccagagccaaggaggatgggaccattttgcagagatctttggcagaga
A0A8C7CBC7_BCL2L1-      atccagagccaaggaggatgggaccgttttgcggagatcttcggcagaga
A0A8C7CBC7_BCL2L1-      atccagagccaaggaggatgggaccgttttgcggagatcttcggcagaga
A0A8C7J9N8_BCL2L1-      atccagagccaaggaggatgggaccggtttgcagagatctttgggatgga
A0A8C7IJ10_BCL2L1-      atccagagccaaggaggatgggaccggtttgcagagatctttgggaagga
A0A8C7IJ10_BCL2L1-      atccagagccaaggaggatgggaccggtttgcagagatctttgggaagga
                        *************************  ***** ******** ** *  **

A0A8C7FX38_BCL2L1-      tgctgctgcagatgttcgacggtcccaggagaacataattaaatggctgc
A0A8C7CBC7_BCL2L1-      tgcagctgcagacgtccgacggtcccaggagagcttaaaaaaatggctgc
A0A8C7CBC7_BCL2L1-      tgcagctgcagacgtccgacggtcccaggagagcttaaaaaaatggctgc
A0A8C7J9N8_BCL2L1-      cgctgcagccgagagcaggaagtctcaggagagctttaagaagtggtttc
A0A8C7IJ10_BCL2L1-      cgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgc
A0A8C7IJ10_BCL2L1-      cgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgc
                         ** ** ** **     *   *** ******* * * *  ** *** * *

A0A8C7FX38_BCL2L1-      tagttggggtgattctgctttcaggagtgctggtcggcactctcatcatg
A0A8C7CBC7_BCL2L1-      tagttggggtgatgctgctttcaggagtactggtcggcactctcatcatg
A0A8C7CBC7_BCL2L1-      tagttggggtgatgctgctttcaggagtactggtcggcactctcatcatg
A0A8C7J9N8_BCL2L1-      tggcggggatgaccctggtcacaggagtcgtcgtagggtcactcttcgct
A0A8C7IJ10_BCL2L1-      ttgctgggatgacactggttacaggagtcatcgtagggtcactcattgct
A0A8C7IJ10_BCL2L1-      ttgctgggatgacactggttacaggagtcatcgtagggtcactcattgct
                        * *  *** ***  *** *  *******  * ** **  * *** *    

A0A8C7FX38_BCL2L1-      aagaaacgccaa--------------------------------------
A0A8C7CBC7_BCL2L1-      aagaaatgccag--------------------------------------
A0A8C7CBC7_BCL2L1-      aagaaatgccagtttgtgtgttaccctgtataccctaggaccaactacat
A0A8C7J9N8_BCL2L1-      cagaaacgcctg--------------------------------------
A0A8C7IJ10_BCL2L1-      cagaaacgcctg--------------------------------------
A0A8C7IJ10_BCL2L1-      cagaaacgcctg--------------------------------------
                         ***** ***                                        

A0A8C7FX38_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      acattctttccaaatggacactttacataacattgaagattctaaaatat
A0A8C7J9N8_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
                                                                          

A0A8C7FX38_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      tgtttttatttagtgtgctccaagaagttaaaccaaacctgttttcattt
A0A8C7J9N8_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
                                                                          

A0A8C7FX38_BCL2L1-      ---------------------------------------tga
A0A8C7CBC7_BCL2L1-      ---------------------------------------tga
A0A8C7CBC7_BCL2L1-      gacattttctttaagtgttccgttccttccttgctgtgctga
A0A8C7J9N8_BCL2L1-      ---------------------------------------tga
A0A8C7IJ10_BCL2L1-      ---------------------------------------tga
A0A8C7IJ10_BCL2L1-      ---------------------------------------tga
                                                               ***

© 1998-2022Legal notice