Dataset for CDS BCL2L1 of organism Oncorhynchus kisutch

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A8C7CBC7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtggacggactgagggggatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtatgccttcctctgcacaagggggaattgaggcggtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgtgccttcagtgacctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcggggccc
tgtgcgttgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcggagatcttcggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaaaaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtga
>gnl|bcl2dbcds|A0A8C7CBC7_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=837 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtggacggactgagggggatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtatgccttcctctgcacaagggggaattgaggcggtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgtgccttcagtgacctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcggggccc
tgtgcgttgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcggagatcttcggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaaaaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtttgtgtgttaccctgtataccctaggaccaactacatacattctttccaaatggacacttta
cataacattgaagattctaaaatattgtttttatttagtgtgctccaagaagttaaaccaaacctgttttcatttgacat
tttctttaagtgttccgttccttccttgctgtgctga
>gnl|bcl2dbcds|A0A8C7FX38_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtagtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgagggagatgaggccattgcaaatgggtctgtggggaactactggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgag
tttgagctgcgctacacccgcgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagtgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggtggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagattggatgaccacatacctggacaac
catatccagccctggatccagagccaaggaggatgggaccattttgcagagatctttggcagagatgctgctgcagatgt
tcgacggtcccaggagaacataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctca
tcatgaagaaacgccaatga
>gnl|bcl2dbcds|A0A8C7IJ10_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=693 residues).
atgtgtattaacctacctgaactggtggtatactatattacctataaactatcacagagagactaccccttcaaccacat
tgggctcacagaagctcccagtcggactgaggggggacaggtggaagggggggcggcagtcacgacacaccccaatggca
cagtgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatgggcctggacgca
gtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctcccagct
acacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtgtgaactggggac
gtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaggagatgagcccactagtgggacgg
attgcagactggatgactgtatacctggacaaccacattcagccctggatccagagccaaggaggatgggaccggtttgc
agagatctttgggaaggacgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgcttgctgggatga
cactggttacaggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C7IJ10_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=696 residues).
attatgacttacaacaacagagaactggtggtatactatattacctataaactatcacagagagactaccccttcaacca
cattgggctcacagaagctcccagtcggactgaggggggacaggtggaagggggggcggcagtcacgacacaccccaatg
gcacagtgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatgggcctggac
gcagtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctccca
gctacacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtgtgaactggg
gacgtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaggagatgagcccactagtggga
cggattgcagactggatgactgtatacctggacaaccacattcagccctggatccagagccaaggaggatgggaccggtt
tgcagagatctttgggaaggacgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgcttgctggga
tgacactggttacaggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C7J9N8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=687 residues).
atgatgacttacaacaacagagaactggtggtatactatatcacctataaactatcacagagggactaccccttcaacca
catggagctcacagaagcccagaatcggactgagggggggcaggtggaagggggtgcggcagtcatgacatacgtcaacg
ggacgagtcccggtactcctccaccacggcagtcgcccccctcctcccctcggcggacagcgggcctggacgcagtgaaa
gaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagctttcagtgacctgtcctcccagctacacat
cacgccgtccacagcctatcagagctttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgggtgg
tgggcctgtttgctttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaaggatcaca
gactggatgaccgtctatctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgcagagat
ctttgggatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggtttctggcggggatgaccctgg
tcacaggagtcgtcgtagggtcactcttcgctcagaaacgcctgtga
© 1998-2022Legal notice