Dataset for CDS BCL-2 of organism Athene cunicularia

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A663MPN9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Athene cunicularia GN=BCL-2 (length=639 residues).
atgcaagaatataacggcagtgattttacttggttgacaaatccccttgcctaccttcctgccatcagaagcagccccac
agctcaccgcacttttccaagtctctcccacagacacgatgcgctccagcatttatcctcgctgcgagctgcccgcaggc
cctgccgggctgcagccccgcggccgcgcagaatcgtccaccttgccctgcgccaggcgggcgacgagttctcccgccgc
taccagagggactttgcccaaatgtccggccagctgcacctgacgcccttcacggccaggggccgcttcgtggcggtggt
ggaggagctcttccgagacggggttaactggggcaggattgtggccttcttcgagtttggcggcgtgatgtgtgtggaga
gcgtcaaccgggagatgtctccccttgtagacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaac
tggatccaggacaacggaggctgggatgccttcgtcgagttgtatggcaacagtgtgaggcctttgtttgatttctcctg
gatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
© 1998-2020Legal notice