Dataset for CDS BCL-2-like of organism Haplochromis burtoni

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q2VNL8_MCL1-01      atggccaa---------------------ctatatgatgttgaaaaggaa
A0A3Q2X557_BCL2L1-      atgtctcaaaacagagaacttgtgcttttctacataaggt------ataa
A0A3Q2UYW8_BCL2-01      atggcgaacgagt---------------------------------ataa
A0A3Q2UUN9_BCL2L10      atgatttatggattatttgtcacccttttttgtaccataccaaaccatga
A0A3Q2UUN9_BCL2L10      atgatttatggattatttgtcacccttttttgtaccataccaaaccatga
                        ***    *                                         *

A0A3Q2VNL8_MCL1-01      cc---------------------------agtgcaccttaatggaatatc
A0A3Q2X557_BCL2L1-      ac----------------tctcccagagaaactatcctctcaaccacata
A0A3Q2UYW8_BCL2-01      tcgca------------atattgtggaaaagtatatctgccataaactct
A0A3Q2UUN9_BCL2L10      ccacacttccgctggttattccgtggcggtg-gtgtcttctttccacagt
A0A3Q2UUN9_BCL2L10      ccacacttccgctggttattccgtggcggtg-gtgtcttctttccacagt
                         *                                  **       *    

A0A3Q2VNL8_MCL1-01      tta--------ttcctcaaaatggagtcttggagggac------------
A0A3Q2X557_BCL2L1-      gtactcaacgagccttcgaacaggactgatgggggggcagcggggttgga
A0A3Q2UYW8_BCL2-01      ccaagcgggg-gt-------------tcgtgtgggg--------------
A0A3Q2UUN9_BCL2L10      ccacacgacg-ttcccagcacaaaaatcatgtcgaga------ggcggag
A0A3Q2UUN9_BCL2L10      ccacacgacg-ttcccagcacaaaaatcatgtcgaga------ggcggag
                          *                       *  **  * *              

A0A3Q2VNL8_MCL1-01      caatgcactacggatcg--------ggaaattc--ctctccgcagaacgc
A0A3Q2X557_BCL2L1-      tgaggaacagcgaatagacacacacgccaatgggacttttaatggcacga
A0A3Q2UYW8_BCL2-01      ------atttcgcgttgtccaagaagaagatgctgctaataacggatcga
A0A3Q2UUN9_BCL2L10      tcacgcattctgcatcagctgaagggaagactcaact------gtaccga
A0A3Q2UUN9_BCL2L10      tcacgcattctgcatcagctgaagggaagactcaact------gtaccga
                              *    *  *          *   *     **          ** 

A0A3Q2VNL8_MCL1-01      cacaggctcctctaaagactctagcaacgggattgtgtccaatggtaccc
A0A3Q2X557_BCL2L1-      gtcccgggaccccaccggcatcccc-------------gcagcggcggca
A0A3Q2UYW8_BCL2-01      taactgaccctccaccgactttggt-------------ccaccggtgccg
A0A3Q2UUN9_BCL2L10      c-gctctccttccgccgtctgta--------------------tgtgcag
A0A3Q2UUN9_BCL2L10      c-gctctccttccgccgtctgta--------------------tgtgcag
                                   *    * *                         *     

A0A3Q2VNL8_MCL1-01      ccaaacggccggacaacctcgaggtaacgtcaacaaacgggtataaaaca
A0A3Q2X557_BCL2L1-      gc-agcagcc-gccatcaacgacgga----------cctcgacgcagt-g
A0A3Q2UYW8_BCL2-01      ag-aa------gccagcaccggg-------------cctgacggc----g
A0A3Q2UUN9_BCL2L10      ag-agcagtctgatatcgctgggaggaaaatgaaattctgtgggctgtgg
A0A3Q2UUN9_BCL2L10      ag-agcagtctgatatcgctgggaggaaaatgaaattctgtgggctgtgg
                           *       *  * *   *                *            

A0A3Q2VNL8_MCL1-01      aaagctatccgggaccgggaggaagacggttcgttgccgagcaccccgga
A0A3Q2X557_BCL2L1-      aaggaggc----gctccgggacacggctaac----------gagttcgag
A0A3Q2UYW8_BCL2-01      agagcaacacccacctctgcagacggctccc---------acagtccga-
A0A3Q2UUN9_BCL2L10      aaagagaccctggttttggccgaggactacctgtccttttgctgcacgag
A0A3Q2UUN9_BCL2L10      aaagagaccctggttttggccgaggactacctgtccttttgctgcacgag
                        *  *              *   * * *                   **  

A0A3Q2VNL8_MCL1-01      gtttcattcggacagtgaatccgacgagcagctggagagagaaacgaaac
A0A3Q2X557_BCL2L1-      ctgcgatacg--------------ctcgtgccttcagc------------
A0A3Q2UYW8_BCL2-01      c--ccacacg--------------caggcatccacagagtcctgcg----
A0A3Q2UUN9_BCL2L10      t--ccacat---------------caagcccctccacctcccagcgaatc
A0A3Q2UUN9_BCL2L10      t--ccacat---------------caagcccctccacctcccagcgaatc
                             *                  *  *   *   *              

A0A3Q2VNL8_MCL1-01      tccttattcacagttttttgggtgactttactg-----gactttctcagc
A0A3Q2X557_BCL2L1-      --------------------------------------gaccttcacagc
A0A3Q2UYW8_BCL2-01      -------------------------cgaggctggagatgaacttgaaaga
A0A3Q2UUN9_BCL2L10      agccgctgc------catgaggcgtctaggctgg----gacatcgaaaga
A0A3Q2UUN9_BCL2L10      agccgctgc------catgaggcgtctaggctgg----gacatcgaaaga
                                                              **  *    ** 

A0A3Q2VNL8_MCL1-01      ctcaacgaaaagaaaccaaagcactaaagacgatgaaaagagttgttgcg
A0A3Q2X557_BCL2L1-      c------------------aac----------------------------
A0A3Q2UYW8_BCL2-01      c------------------tgtaccagccg---------gacttcacgga
A0A3Q2UUN9_BCL2L10      c------------------agcaccaagctcgcttcgacaacctcgctca
A0A3Q2UUN9_BCL2L10      c------------------agcaccaagctcgcttcgacaacctcgctca

A0A3Q2VNL8_MCL1-01      gacgtattagaaa-----agcacagatacgcttacaacggaatgattaat
A0A3Q2X557_BCL2L1-      ------------------tgcac-------atcacgcc------------
A0A3Q2UYW8_BCL2-01      gatgtcgcggcagc----tgcat-------ctcacctc------------
A0A3Q2UUN9_BCL2L10      gaccttcctggtgcagtgtggac-------cggaccac------------
A0A3Q2UUN9_BCL2L10      gaccttcctggtgcagtgtggac-------cggaccac------------
                                           * *           **  *            

A0A3Q2VNL8_MCL1-01      aaattgtcattggatgaaagagacgaggatatgtcatttgtcggtgctgt
A0A3Q2X557_BCL2L1-      ----ggccacggcctaccaaagct----------------tcgagaacgt
A0A3Q2UYW8_BCL2-01      ----cgccacggcgcagaggaggt----------------tcgccgaggt
A0A3Q2UUN9_BCL2L10      ----tgcctcagc----------c----------------tcagaaaggt
A0A3Q2UUN9_BCL2L10      ----tgcctcagc----------c----------------tcagaaaggt
                             * *   *                            **      **

A0A3Q2VNL8_MCL1-01      agcgaagagcctctttggagaccacacgaccaactggggtcgtattgtca
A0A3Q2X557_BCL2L1-      gatggacgaggtgttccgggacggc---gttaactggggccgcatcgtag
A0A3Q2UYW8_BCL2-01      gatagacgaactgttccgggacggg---gtgaactggggccggattattg
A0A3Q2UUN9_BCL2L10      gatgaaggagctggttggagatggacacttgaactgggggagggttgttt
A0A3Q2UUN9_BCL2L10      gatgaaggagctggttggagatggacacttgaactgggggagggttgttt
                             *     *  *  * **          ********  *  *  *  

A0A3Q2VNL8_MCL1-01      gctttatggccttc---ggggcagtggtctctcagcacctgaaggaaaag
A0A3Q2X557_BCL2L1-      ggcttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaag---
A0A3Q2UYW8_BCL2-01      ctttcttcgagtttg--ggggcactgt-------gtgcgtggagtg----
A0A3Q2UUN9_BCL2L10      ctcttttcgcctttactggagtgctggccagaaagatcctggagcagaag
A0A3Q2UUN9_BCL2L10      ctcttttcgcctttactggagtgctggccagaaagatcctggagcagaag
                           *  * *  **    ** *   **        *  * *  **      

A0A3Q2VNL8_MCL1-01      ----------------------ggcagggacaactacgtggcgctagtga
A0A3Q2X557_BCL2L1-      --------------------------------gagatgagccccttggtg
A0A3Q2UYW8_BCL2-01      ---------------cgcttccaacgag----gggatgtcatcccaggtg
A0A3Q2UUN9_BCL2L10      ccggggctggaccctcgtcaacagcaggaactgggacaggagccca--tg
A0A3Q2UUN9_BCL2L10      ccggggctggaccctcgtcaacagcaggaactgggacaggagccca--tg
                                                           *       *      

A0A3Q2VNL8_MCL1-01      gccaaga--gatttctgc--------atacctg-ctgtctgaacagcgag
A0A3Q2X557_BCL2L1-      ggcaggatcgtagagtgg--------atgacggtctacctagacaaccac
A0A3Q2UYW8_BCL2-01      gacaacatcgcagactgg--------atgacggagtatttaaatggacct
A0A3Q2UUN9_BCL2L10      agctgca--gaaggctggcagagaccatagctgattacctgggagaagag
A0A3Q2UUN9_BCL2L10      agctgca--gaaggctggcagagaccatagctgattacctgggagaagag
                          *   *  *     **         **  * *  *   *          

A0A3Q2VNL8_MCL1-01      a-------ctggattgtaaaaaacaatgcatgggatggctttgtggagtt
A0A3Q2X557_BCL2L1-      attcagccctggatccagagccaaggaggatgggagcgcttcgctgaaat
A0A3Q2UYW8_BCL2-01      cttaacagctggatacaagataacgggggatgggatgcatttgtggagct
A0A3Q2UUN9_BCL2L10      aagaaagactggctgttggataatgatggatgggaaggcttctgtaagtt
A0A3Q2UUN9_BCL2L10      aagaaagactggctgttggataatgatggatgggaaggcttctgtaagtt
                                **** *        *    * ******    **     *  *

A0A3Q2VNL8_MCL1-01      ctttcg-------------------agtagcagaccctgagtcgatagtc
A0A3Q2X557_BCL2L1-      cttcgg-------gcaggatgcggcggctgaaagccggaggtc-----tc
A0A3Q2UYW8_BCL2-01      gtacgacagacagagggactccgtcttcagttgctcctggccc-tccatc
A0A3Q2UUN9_BCL2L10      ctcccgcagtgccagaga----------agtgagccaggactcatccatg
A0A3Q2UUN9_BCL2L10      ctcccgcagtgccagaga----------agtgagccaggactcatccatg
                         *                           *     *      *     * 

A0A3Q2VNL8_MCL1-01      aggcacacgct----catggcctttgctggatttgctggtattggg----
A0A3Q2X557_BCL2L1-      aggagagtttcaagaagtggctgctggtggggatgacggtggtgacaggc
A0A3Q2UYW8_BCL2-01      aagacagtttt-cggcttggctgcgctcggagcggcca------------
A0A3Q2UUN9_BCL2L10      aagaaagcgct----gtttgctgccgccgg---tgtcg------------
A0A3Q2UUN9_BCL2L10      aagaaagcgct----gtttgctgccgccgg---tgtcg------------
                        * *              * **       **    *               

A0A3Q2VNL8_MCL1-01      gcaacactggccctgttgatc------agtggtttgtaa
A0A3Q2X557_BCL2L1-      gttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
A0A3Q2UYW8_BCL2-01      gcctcaccatcggagcataccttacacaaaag----tga
A0A3Q2UUN9_BCL2L10      gccttgct----gggcttaccttcctcttggtgcgctag
A0A3Q2UUN9_BCL2L10      gccttgct----gggcttaccttcctcttg------tga
                        *             *   * *               *  

© 1998-2022Legal notice