Dataset for CDS BCL2L1 of organism Gopherus agassizii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A452ILL8_BCL2L1-      atgtcgaacactaacagggaattagtgattgactttctctcctacaagct
A0A452ILL8_BCL2L1-      atgtcgaacactaacagggaattagtgattgactttctctcctacaagct

A0A452ILL8_BCL2L1-      atcgcagaggggatacagctggagtcggttcgaaggggaggatgagatca
A0A452ILL8_BCL2L1-      atcgcagaggggatacagctggagtcggttcgaaggggaggatgagatca

A0A452ILL8_BCL2L1-      ggactgattctgcagaagaggctgagatggcaagtgtccctaatgggagt
A0A452ILL8_BCL2L1-      ggactgattctgcagaagaggctgagatggcaagtgtccctaatgggagt

A0A452ILL8_BCL2L1-      ccatcctggcatccgggtgccagccacatagtgaatggggctgctgggca
A0A452ILL8_BCL2L1-      ccatcctggcatccgggtgccagccacatagtgaatggggctgctgggca

A0A452ILL8_BCL2L1-      cagtaacagccttgaagcccatgaaagggttccagcaactggagtgaggc
A0A452ILL8_BCL2L1-      cagtaacagccttgaagcccatgaaagggttccagcaactggagtgaggc

A0A452ILL8_BCL2L1-      aggcgctgagagaggcaggagatgagtttgaattgaggtatcggagggct
A0A452ILL8_BCL2L1-      aggcgctgagagaggcaggagatgagtttgaattgaggtatcggagggct

A0A452ILL8_BCL2L1-      ttcagtgacctcacttcccaactccacatcactcctggcacggcatacca
A0A452ILL8_BCL2L1-      ttcagtgacctcacttcccaactccacatcactcctggcacggcatacca

A0A452ILL8_BCL2L1-      gagctttgagcaggtagtgaatgaactcttccgggacggagtgaactggg
A0A452ILL8_BCL2L1-      gagctttgagcaggtagtgaatgaactcttccgggacggagtgaactggg

A0A452ILL8_BCL2L1-      ggcgcattgtggcttttttctcctttggaggagccctgtgtgtggagagt
A0A452ILL8_BCL2L1-      ggcgcattgtggcttttttctcctttggaggagccctgtgtgtggagagt

A0A452ILL8_BCL2L1-      gtcgacaaggagatgcaggtgttggttggacgcatcgtctcatggatgac
A0A452ILL8_BCL2L1-      gtcgacaaggagatgcaggtgttggttggacgcatcgtctcatggatgac

A0A452ILL8_BCL2L1-      cacttacctgactgaccacctagatccctggatccaagagaatggcggtt
A0A452ILL8_BCL2L1-      cacttacctgactgaccacctagatccctggatccaagagaatggcggtt

A0A452ILL8_BCL2L1-      gggagcggtttgtggatctctatgggaatgacgctgctgccaagagcagg
A0A452ILL8_BCL2L1-      gggagcggtttgtggatctctatgggaatgacgctgctgccaagagcagg

A0A452ILL8_BCL2L1-      aaaggccaggagcagttcaacaggtggcttctgaccggggcgactctggc
A0A452ILL8_BCL2L1-      aaaggccaggagcagttcaacaggtggcttctgaccggggcgactctggc

A0A452ILL8_BCL2L1-      aggagtgctcctgctgggctctctgctgagccgcaagtaa
A0A452ILL8_BCL2L1-      aggagtgctcctgctgggctctctgctgagccgcaagtaa

© 1998-2022Legal notice