Dataset for CDS BAX-like of Organism Castor canadensis

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A250YBQ3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Castor canadensis GN=BAX (length=579 residues).
atggatgggtccggggagcagcccagaggaggcgggcccaccagctctgagcagatcatgaagacgggggcccttttgct
tcagggtttcatccaggatcgagcagggcggatggggggggagacaccggagctgaccttggagcagatgcaccaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaatatggagctgcagaggatgatt
gcagatgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgtttgccgacggcaacttcaattg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtaccggagctgatca
gaaccatcatgggctggacgctggaattcctccgagaacggctgctaggctggatccaagaccagggtggttgggacggc
ctcctttcctactttgggacccccacgtggcagacagtgaccatctttgtggctggagtgctcactgcctcgctcaccat
ttggaagaagatgggctga
>gnl|bcl2dbcds|A0A250YBQ3_BAX-02 BCL2-associated X gene OS=[Eukaryota] Castor canadensis GN=BAX (length=522 residues).
atgaagacgggggcccttttgcttcagggtttcatccaggatcgagcagggcggatggggggggagacaccggagctgac
cttggagcagatgcaccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagta
atatggagctgcagaggatgattgcagatgtggacacagactccccccgagaggtctttttccgagtggcagctgacatg
tttgccgacggcaacttcaattggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtg
caccaaggtaccggagctgatcagaaccatcatgggctggacgctggaattcctccgagaacggctgctaggctggatcc
aagaccagggtggttgggacggcctcctttcctactttgggacccccacgtggcagacagtgaccatctttgtggctgga
gtgctcactgcctcgctcaccatttggaagaagatgggctga
>gnl|bcl2dbcds|A0A250YC64_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Castor canadensis GN=BAK1 (length=501 residues).
atggcatctggacaaggcccaggtcctcccaaggagggattggaagagccttcctcagactccacttctgagcagcaggt
agtccaggacacggaggaggttttccgcagctacgttttttaccgccaccagcaggaacaggaggctcagggggcagctg
ctcctgctgacccagagttggtgtccttgccacaagaacctaacagcaccatggggcaggtgggccggcggcttgccatc
attggggatgatattaaccggcgctatgacaccgagttccagaccatgctgcagcagctacggcccacagctgagaatgc
ctctgagctcttcaccaagattgcctccaggtgcacagcctggcctctctgtccactgtcccgtcaccacccatgcatgc
aatgggctccctggagtgggcacacttctctggcagtgtcagggggcagtgtgttaactcacatgtggtctctgagtcct
ctactgtgcataaactcatga
>gnl|bcl2dbcds|A0A250YC64_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Castor canadensis GN=BAK1 (length=636 residues).
atggcatctggacaaggcccaggtcctcccaaggagggattggaagagccttcctcagactccacttctgagcagcaggt
agtccaggacacggaggaggttttccgcagctacgttttttaccgccaccagcaggaacaggaggctcagggggcagctg
ctcctgctgacccagagttggtgtccttgccacaagaacctaacagcaccatggggcaggtgggccggcggcttgccatc
attggggatgatattaaccggcgctatgacaccgagttccagaccatgctgcagcagctacggcccacagctgagaatgc
ctctgagctcttcaccaagattgcctccagtctgtttgacagtggcatcagctggggccgtgtggtggctctcttgagct
ttggctatcgcctggctgtgcatgtctaccagcgtggcctgactggcttcttgggtcaggtgacctattttgtgattgac
gtcatgctgcggcactacattacccggtggatcgcacagagaggaggttgggtggcagccctggaattgggcaacggccc
catccggaatgtggtgatagttctggctgtggttctgttgggccagtttgtggtacgaagattcttcaagtcatga
>gnl|bcl2dbcds|A0A250YC64_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Castor canadensis GN=BAK1 (length=417 residues).
atggcatctggacaaggcccaggtcctcccaaggagggattggaagagccttcctcagactccacttctgagcagcaggt
agtccaggacacggaggaggttttccgcagctacgttttttaccgccaccagcaggaacaggaggctcagggggcagctg
ctcctgctgacccagagttggtgtccttgccacaagaacctaacagcaccatggggcaggtgggccggcggcttgccatc
attggggatgatattaaccggcgctatgacaccgagttccagaccatgctgcagcagctacggcccacagctgagaatgc
ctctgagctcttcaccaagattgcctccaggccagcagcaacgcccacagtctgtttgacagtggcatcagctggggccg
tgtggtggctctcttga
© 1998-2020Legal notice