Dataset for CDS BAX-like of Organism Castor canadensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A250YBQ3_BAX-01       atggatgggtccggggagcagcccagaggaggcgggcccaccagctctga
A0A250YBQ3_BAX-02       --------------------------------------------------
A0A250YC64_BAK1-01      atgg----------------------------------------------
A0A250YC64_BAK1-02      atgg----------------------------------------------
A0A250YC64_BAK1-03      atgg----------------------------------------------

A0A250YBQ3_BAX-01       gcagatcatgaagacgggggcccttttgcttcagggtttcatccaggatc
A0A250YBQ3_BAX-02       -------atgaagacgggggcccttttgcttcagggtttcatccaggatc
A0A250YC64_BAK1-01      ------catctggacaaggccc------------aggtcctccca-----
A0A250YC64_BAK1-02      ------catctggacaaggccc------------aggtcctccca-----
A0A250YC64_BAK1-03      ------catctggacaaggccc------------aggtcctccca-----
                               **   ***  ** **             * * *  ***     

A0A250YBQ3_BAX-01       gagcagggcggatgggggggg--------agacaccggagctgaccttgg
A0A250YBQ3_BAX-02       gagcagggcggatgggggggg--------agacaccggagctgaccttgg
A0A250YC64_BAK1-01      ----aggagggattggaagagccttcctcagactccacttctga----gc
A0A250YC64_BAK1-02      ----aggagggattggaagagccttcctcagactccacttctga----gc
A0A250YC64_BAK1-03      ----aggagggattggaagagccttcctcagactccacttctga----gc
                            ***  **** **  * *        **** **    ****    * 

A0A250YBQ3_BAX-01       agcagatgcaccaggatgcgtccaccaagaagctg-----agcgagtgtc
A0A250YBQ3_BAX-02       agcagatgcaccaggatgcgtccaccaagaagctg-----agcgagtgtc
A0A250YC64_BAK1-01      agcaggtagtccaggacacgg-----aggaggttttccgcagctacgttt
A0A250YC64_BAK1-02      agcaggtagtccaggacacgg-----aggaggttttccgcagctacgttt
A0A250YC64_BAK1-03      agcaggtagtccaggacacgg-----aggaggttttccgcagctacgttt
                        ***** *   ******  **      * ** * *      *** *   * 

A0A250YBQ3_BAX-01       tcaagcgcatcggggacgaactggacagtaatatggagctgcagaggatg
A0A250YBQ3_BAX-02       tcaagcgcatcggggacgaactggacagtaatatggagctgcagaggatg
A0A250YC64_BAK1-01      tttaccgccaccagcaggaacagga-----------ggct-cagggggca
A0A250YC64_BAK1-02      tttaccgccaccagcaggaacagga-----------ggct-cagggggca
A0A250YC64_BAK1-03      tttaccgccaccagcaggaacagga-----------ggct-cagggggca
                        *  * ***  *  * * **** ***            *** *** **   

A0A250YBQ3_BAX-01       attgcagatgtggacacaga---------ctccccccgagaggtcttttt
A0A250YBQ3_BAX-02       attgcagatgtggacacaga---------ctccccccgagaggtcttttt
A0A250YC64_BAK1-01      gctgctcctgctgacccagagttggtgtccttgccacaagaa--------
A0A250YC64_BAK1-02      gctgctcctgctgacccagagttggtgtccttgccacaagaa--------
A0A250YC64_BAK1-03      gctgctcctgctgacccagagttggtgtccttgccacaagaa--------
                          ***   **  *** ****         **  ** * ***         

A0A250YBQ3_BAX-01       ccgagtggcagc---tgacatgtttgccgacggc-aacttcaattggggc
A0A250YBQ3_BAX-02       ccgagtggcagc---tgacatgtttgccgacggc-aacttcaattggggc
A0A250YC64_BAK1-01      cctaacagcaccatggggcaggtgggccggcggcttgccatcattgggga
A0A250YC64_BAK1-02      cctaacagcaccatggggcaggtgggccggcggcttgccatcattgggga
A0A250YC64_BAK1-03      cctaacagcaccatggggcaggtgggccggcggcttgccatcattgggga
                        ** *   *** *    * ** **  **** ****   *    ******* 

A0A250YBQ3_BAX-01       cgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccct
A0A250YBQ3_BAX-02       cgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccct
A0A250YC64_BAK1-01      tga---------------tatt---------aaccggcgct-atgacacc
A0A250YC64_BAK1-02      tga---------------tatt---------aaccggcgct-atgacacc
A0A250YC64_BAK1-03      tga---------------tatt---------aaccggcgct-atgacacc
                         *                ** *         *** ** *** * * * * 

A0A250YBQ3_BAX-01       gtgcaccaag--gtaccggagctgatcagaaccatcatgggctggacgct
A0A250YBQ3_BAX-02       gtgcaccaag--gtaccggagctgatcagaaccatcatgggctggacgct
A0A250YC64_BAK1-01      gagttccagaccatgctgcagcagctacggcccac----agctg------
A0A250YC64_BAK1-02      gagttccagaccatgctgcagcagctacggcccac----agctg------
A0A250YC64_BAK1-03      gagttccagaccatgctgcagcagctacggcccac----agctg------
                        * *  ***     * * * *** * *  *  ***      ****      

A0A250YBQ3_BAX-01       ggaattcctccgagaacggctgctaggctggatccaagaccagggtggtt
A0A250YBQ3_BAX-02       ggaattcctccgagaacggctgctaggctggatccaagaccagggtggtt
A0A250YC64_BAK1-01      agaatgcctctgagctcttcaccaagattgcctccaggtgcacagcc---
A0A250YC64_BAK1-02      agaatgcctctgagctcttcaccaagattgcctc----------------
A0A250YC64_BAK1-03      agaatgcctctgagctcttcaccaagattgcctccaggccagcagcaacg
                         **** **** ***  *  *  * **  **  **                

A0A250YBQ3_BAX-01       gggacggcctcctttcctacttt---gggacccccacgtggcagacagtg
A0A250YBQ3_BAX-02       gggacggcctcctttcctacttt---gggacccccacgtggcagacagtg
A0A250YC64_BAK1-01      ----tggcctctctgtccactgtcccgtcaccacccatg--catgcaatg
A0A250YC64_BAK1-02      ----cagtctgtttg---acagt---ggcatcagctggggccgtgtggt-
A0A250YC64_BAK1-03      cccacagtctgtttg---acagt---ggcatcagctggggccgtgtggt-
                              * **   *    **  *   *  * *  *      *      * 

A0A250YBQ3_BAX-01       accatctttgtggctggagtgctcactgcctcgctc--------------
A0A250YBQ3_BAX-02       accatctttgtggctggagtgctcactgcctcgctc--------------
A0A250YC64_BAK1-01      ggctccctggagtgggcacacttctctggcagtgtc--------------
A0A250YC64_BAK1-02      ggctctcttgagctttggctatcgcctggctgtgcatgtctaccagcgtg
A0A250YC64_BAK1-03      ggctctcttga---------------------------------------
                          *    * *                                        

A0A250YBQ3_BAX-01       --------------------------------------------------
A0A250YBQ3_BAX-02       --------------------------------------------------
A0A250YC64_BAK1-01      --------------------------------------------------
A0A250YC64_BAK1-02      gcctgactggcttcttgggtcaggtgacctattttgtgattgacgtcatg
A0A250YC64_BAK1-03      --------------------------------------------------

A0A250YBQ3_BAX-01       --------------------------accatttggaagaagatgggc---
A0A250YBQ3_BAX-02       --------------------------accatttggaagaagatgggc---
A0A250YC64_BAK1-01      -----------------------------------agggggcagtgtgtt
A0A250YC64_BAK1-02      ctgcggcactacattacccggtggatcgcacagagaggaggttgggtggc
A0A250YC64_BAK1-03      --------------------------------------------------

A0A250YBQ3_BAX-01       --------------------------------------------------
A0A250YBQ3_BAX-02       --------------------------------------------------
A0A250YC64_BAK1-01      aactcacatgtggtctctgagtcctctactg-------------------
A0A250YC64_BAK1-02      agccctggaattgggcaacggccccatccggaatgtggtgatagttctgg
A0A250YC64_BAK1-03      --------------------------------------------------

A0A250YBQ3_BAX-01       -----------------------------------------------tga
A0A250YBQ3_BAX-02       -----------------------------------------------tga
A0A250YC64_BAK1-01      -----------------------------------tgcataaactcatga
A0A250YC64_BAK1-02      ctgtggttctgttgggccagtttgtggtacgaagattcttcaagtcatga
A0A250YC64_BAK1-03      --------------------------------------------------

© 1998-2020Legal notice