Dataset for CDS MCL-1 of organism Sander lucioperca

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C9XS62_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sander lucioperca GN=MCL-1 (length=813 residues).
atgtctttgaaactgcacgacaacatggacaaggctcccctgtttaccttgaaccgttggggactcctcgaaaccgacag
tgccggagcgtgctccagtgacttccgcatactgggaccgcaagcaaacatgcactacattcatggtacggttgacgctc
actattgtttcagttgtaagtgcacaattagcaactttgtggagaacgacaccttactgggtgaacacctctatcacagc
aacggcaattccttggcaggtgaacccggcatcaccttgatatcccgagactcgccggacaatgagactaggcaactcat
acaaaggtgcctagacgacttcacgggacttgtgaaacctacgtgggatgaaagcaaagctctgtctacaatgaaaagag
ttgtggctggcctattgcagaaatacagatgtgaatataatggtctggtcaaacgtgtattggagcattggaccagaaat
gatgacatggggtttgtcagccagatagctatgaacatgttcaatgatgggaccatgaactggggccgcattgccagctt
gatagcatttggtgctgctttgtgtcagcgcttcaatgagattggcaaagaggactgtgtggcgcgagtgggagaggaaa
tctccctgtacctgctgactgtccacacggactggctggttagaaacgactcctggaacggctttgtggagttctttcgg
gtcccagaccaggagtctactttgacaaacatactcctcacggctgctggatttgctggcattggggctgctctgacctt
gttgatcaattga
>gnl|bcl2dbcds|A0A8C9XY04_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sander lucioperca GN=MCL-1 (length=852 residues).
atgaatattattccggcgaaacggaccgcgttcaacgtaacgaccggagtcatgagctgttttattcatcctcaaaatgg
agtcgtggagggaccaattctctacggctcagggaattcctccccgcagattgcaatgggctcatctaaagaatctcaca
acggaaatgcggggtcaaacgataccctgaaacgaccgaagaacctgggagtgaacgggtatgtaacaaaaagcctccgg
gaggacaacgacgaaatcgaggacggctcattgccgtgtactccggagccagacggtgaaatcgacgtctccagttgccc
ggcaggtgatgcagtcctggagaacgacacgaggcaactcattggccgtttcctgagagactttactggactttcgaaag
caaagtggaatgaaagccgagcactagcaacaatgaaaagagttgtggagggcgttttggagaaacacagatacgcatac
aatggtatgatcaacaaattgtcattggatgaaagaacggatgacgccagttttgtcagtgcagtagccaagagcctctt
tgcagacggaaccaccaactggggtcgtatcgccagcctgctggccttcggggcagtggtgtcacaatacctgaaggagc
gaggcagggagaactgtgtggagctggtgggacaggagatctccacgtatttgctaagcgaccagcgggactggctggtc
aaaaacaatgcctgggatggctttgtcgagttcttcagagtagcagacccagagtccacagtgaggaacacactcatggc
ctttgctggatttgctggtattggggcgacactggccctgttgatcaggtga
© 1998-2023Legal notice