Dataset for CDS BCL2L1 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

14 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q07817_BCL2L1-12      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-03      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-04      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-05      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-06      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-07      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-08      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-09      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-10      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-11      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-02      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-14      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-15      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
                      **************************************************

Q07817_BCL2L1-12      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-01      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-03      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-04      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-05      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-06      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-07      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-08      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-09      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-10      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-11      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-02      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-14      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-15      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
                      **************************************************

Q07817_BCL2L1-12      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-01      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-03      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-04      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-05      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-06      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-07      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-08      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-09      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-10      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-11      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-02      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-14      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-15      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
                      **************************************************

Q07817_BCL2L1-12      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-01      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-03      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-04      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-05      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-06      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-07      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-08      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-09      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-10      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-11      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-02      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-14      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-15      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
                      **************************************************

Q07817_BCL2L1-12      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-01      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-03      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-04      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-05      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-06      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-07      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-08      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-09      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-10      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-11      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-02      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-14      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-15      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
                      **************************************************

Q07817_BCL2L1-12      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-01      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-03      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-04      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-05      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-06      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-07      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-08      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-09      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-10      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-11      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-02      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-14      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-15      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
                      **************************************************

Q07817_BCL2L1-12      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-01      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-03      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-04      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-05      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-06      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-07      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-08      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-09      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-10      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-11      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-02      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-14      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-15      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
                      **************************************************

Q07817_BCL2L1-12      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-01      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-03      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-04      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-05      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-06      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-07      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-08      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-09      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-10      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-11      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-02      gacagcatatcagagctttga-----------------------------
Q07817_BCL2L1-14      gacagcatatcagagctttga-----------------------------
Q07817_BCL2L1-15      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
                      *********************                             

Q07817_BCL2L1-12      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-01      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-03      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-04      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-05      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-06      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-07      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-08      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-09      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-10      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-11      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
                                                                        

Q07817_BCL2L1-12      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q07817_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q07817_BCL2L1-03      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q07817_BCL2L1-04      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q07817_BCL2L1-05      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q07817_BCL2L1-06      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q07817_BCL2L1-07      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q07817_BCL2L1-08      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q07817_BCL2L1-09      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q07817_BCL2L1-10      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q07817_BCL2L1-11      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                                                                        

Q07817_BCL2L1-12      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
Q07817_BCL2L1-01      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
Q07817_BCL2L1-03      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
Q07817_BCL2L1-04      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
Q07817_BCL2L1-05      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
Q07817_BCL2L1-06      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
Q07817_BCL2L1-07      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
Q07817_BCL2L1-08      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
Q07817_BCL2L1-09      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
Q07817_BCL2L1-10      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
Q07817_BCL2L1-11      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
                                                                        

Q07817_BCL2L1-12      agaacggcggctg-------------------------------------
Q07817_BCL2L1-01      agaacggcggctg-------------------------------------
Q07817_BCL2L1-03      agaacggcggctg-------------------------------------
Q07817_BCL2L1-04      agaacggcggctg-------------------------------------
Q07817_BCL2L1-05      agaacggcggctg-------------------------------------
Q07817_BCL2L1-06      agaacggcggctg-------------------------------------
Q07817_BCL2L1-07      agaacggcggctg-------------------------------------
Q07817_BCL2L1-08      agaacggcggctg-------------------------------------
Q07817_BCL2L1-09      agaacggcggctg-------------------------------------
Q07817_BCL2L1-10      agaacggcggctg-------------------------------------
Q07817_BCL2L1-11      agaacggcggctg-------------------------------------
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      agaacggcggctggctggattggtggtgcttctgctcagctcaccttaga
                                                                        

Q07817_BCL2L1-12      --------------------------------------------------
Q07817_BCL2L1-01      --------------------------------------------------
Q07817_BCL2L1-03      --------------------------------------------------
Q07817_BCL2L1-04      --------------------------------------------------
Q07817_BCL2L1-05      --------------------------------------------------
Q07817_BCL2L1-06      --------------------------------------------------
Q07817_BCL2L1-07      --------------------------------------------------
Q07817_BCL2L1-08      --------------------------------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-10      --------------------------------------------------
Q07817_BCL2L1-11      --------------------------------------------------
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      gtaatcatcactgacggaggagactggggaggtcccatccttcccctggg
                                                                        

Q07817_BCL2L1-12      --------------------------------------------------
Q07817_BCL2L1-01      --------------------------------------------------
Q07817_BCL2L1-03      --------------------------------------------------
Q07817_BCL2L1-04      --------------------------------------------------
Q07817_BCL2L1-05      --------------------------------------------------
Q07817_BCL2L1-06      --------------------------------------------------
Q07817_BCL2L1-07      --------------------------------------------------
Q07817_BCL2L1-08      --------------------------------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-10      --------------------------------------------------
Q07817_BCL2L1-11      --------------------------------------------------
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      ctcagctgggtccccagacctacacctgaaccccacgcctgtctggtgtt
                                                                        

Q07817_BCL2L1-12      --------------------------------------------------
Q07817_BCL2L1-01      --------------------------------------------------
Q07817_BCL2L1-03      --------------------------------------------------
Q07817_BCL2L1-04      --------------------------------------------------
Q07817_BCL2L1-05      --------------------------------------------------
Q07817_BCL2L1-06      --------------------------------------------------
Q07817_BCL2L1-07      --------------------------------------------------
Q07817_BCL2L1-08      --------------------------------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-10      --------------------------------------------------
Q07817_BCL2L1-11      --------------------------------------------------
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      tacggattgaagctgccaccctttgggacctatcctgttttcatttctgc
                                                                        

Q07817_BCL2L1-12      --------------------------------------------------
Q07817_BCL2L1-01      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-03      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-04      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-05      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-06      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-07      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-08      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-09      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-10      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-11      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-02      --------------------------------acaggatacttttgtgga
Q07817_BCL2L1-14      --------------------------------acaggatacttttgtgga
Q07817_BCL2L1-15      tctcagctctctggtctctgtggacctcacttacaggatacttttgtgga
                                                                        

Q07817_BCL2L1-12      -----------------------------------ggtgccaga------
Q07817_BCL2L1-01      actctatgggaacaatgcagcagccgagagccgaaagggccaggaacgct
Q07817_BCL2L1-03      actctatgggaacaatgcagcagccgagagccgaaagggccaggaacgct
Q07817_BCL2L1-04      actctatgggaacaatgcagcagccgagagccgaaagggccaggaacgct
Q07817_BCL2L1-05      actctatgggaacaatgcagcagccgagagccgaaagggccaggaacgct
Q07817_BCL2L1-06      actctatgggaacaatgcagcagccgagagccgaaagggccaggaacgct
Q07817_BCL2L1-07      actctatgggaacaatgcagcagccgagagccgaaagggccaggaacgct
Q07817_BCL2L1-08      actctatgggaacaatgcagcagccgagagccgaaagggccaggaacgct
Q07817_BCL2L1-09      actctatgggaacaatgcagcagccgagagccgaaagggccaggaacgct
Q07817_BCL2L1-10      actctatgggaacaatgcagcagccgagagccgaaagggccaggaacgct
Q07817_BCL2L1-11      actctatgggaacaatgcagcagccgagagccgaaagggccaggaacgct
Q07817_BCL2L1-02      actctatgggaacaatgcagcagccgagagccgaaagggccaggaacgct
Q07817_BCL2L1-14      actctatgggaacaatgcagcagccgagagccgaaagggccaggaacgct
Q07817_BCL2L1-15      actctatgggaacaatgcagcagccgagagccgaaagggccaggaacgct
                                                          * *****       

Q07817_BCL2L1-12      -----tgccagttttaga---------------------------ttctg
Q07817_BCL2L1-01      tcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctg
Q07817_BCL2L1-03      tcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctg
Q07817_BCL2L1-04      tcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctg
Q07817_BCL2L1-05      tcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctg
Q07817_BCL2L1-06      tcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctg
Q07817_BCL2L1-07      tcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctg
Q07817_BCL2L1-08      tcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctg
Q07817_BCL2L1-09      tcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctg
Q07817_BCL2L1-10      tcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctg
Q07817_BCL2L1-11      tcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctg
Q07817_BCL2L1-02      tcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctg
Q07817_BCL2L1-14      tcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctg
Q07817_BCL2L1-15      tcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctg
                            **  ***   **                           * ***

Q07817_BCL2L1-12      gctccacc-----------actga
Q07817_BCL2L1-01      ggctcactcttcagtcggaaatga
Q07817_BCL2L1-03      ggctcactcttcagtcggaaatga
Q07817_BCL2L1-04      ggctcactcttcagtcggaaatga
Q07817_BCL2L1-05      ggctcactcttcagtcggaaatga
Q07817_BCL2L1-06      ggctcactcttcagtcggaaatga
Q07817_BCL2L1-07      ggctcactcttcagtcggaaatga
Q07817_BCL2L1-08      ggctcactcttcagtcggaaatga
Q07817_BCL2L1-09      ggctcactcttcagtcggaaatga
Q07817_BCL2L1-10      ggctcactcttcagtcggaaatga
Q07817_BCL2L1-11      ggctcactcttcagtcggaaatga
Q07817_BCL2L1-02      ggctcactcttcagtcggaaatga
Q07817_BCL2L1-14      ggctcactcttcagtcggaaatga
Q07817_BCL2L1-15      ggctcactcttcagtcggaaatga
                      *   ***            * ***

© 1998-2021Legal notice