Dataset for CDS BCL2L1 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q07817_BCL2L1-02      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-09      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-07      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-04      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-05      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-06      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-08      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-03      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
                      **************************************************

Q07817_BCL2L1-02      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-09      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-07      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-04      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-05      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-06      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-08      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-01      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-03      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
                      **************************************************

Q07817_BCL2L1-02      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-09      ggactgaggccccagaagggactgaatcggagatggagacccccag----
Q07817_BCL2L1-07      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-04      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-05      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-06      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-08      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-01      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-03      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
                      **********************************************    

Q07817_BCL2L1-02      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-07      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-04      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-05      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-06      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-08      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-01      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-03      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
                                                                        

Q07817_BCL2L1-02      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-07      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-04      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-05      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-06      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-08      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-01      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-03      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
                                                                        

Q07817_BCL2L1-02      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-07      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-04      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-05      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-06      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-08      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-01      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-03      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
                                                                        

Q07817_BCL2L1-02      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-07      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-04      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-05      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-06      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-08      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-01      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-03      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
                                                                        

Q07817_BCL2L1-02      gacagcatatcagagctttgaacagg------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-07      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-04      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-05      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-06      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-08      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-01      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-03      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
                                                                        

Q07817_BCL2L1-02      -------------------------------atacttttgtggaactcta
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-07      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-04      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-05      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-06      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-08      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-01      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-03      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
                                                                        

Q07817_BCL2L1-02      tgggaacaatgcagcagccgag----------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-07      tgcgtggaaagc-gtagacaaggagatgcaggtattggtgagtcggatcg
Q07817_BCL2L1-04      tgcgtggaaagc-gtagacaaggagatgcaggtattggtgagtcggatcg
Q07817_BCL2L1-05      tgcgtggaaagc-gtagacaaggagatgcaggtattggtgagtcggatcg
Q07817_BCL2L1-06      tgcgtggaaagc-gtagacaaggagatgcaggtattggtgagtcggatcg
Q07817_BCL2L1-08      tgcgtggaaagc-gtagacaaggagatgcaggtattggtgagtcggatcg
Q07817_BCL2L1-01      tgcgtggaaagc-gtagacaaggagatgcaggtattggtgagtcggatcg
Q07817_BCL2L1-03      tgcgtggaaagc-gtagacaaggagatgcaggtattggtgagtcggatcg
                                                                        

Q07817_BCL2L1-02      -agccgaaagggcc----------aggaacgcttcaaccgctggttcctg
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-07      cagcttggatggccacttacctgaatgaccacctagagccttggatccag
Q07817_BCL2L1-04      cagcttggatggccacttacctgaatgaccacctagagccttggatccag
Q07817_BCL2L1-05      cagcttggatggccacttacctgaatgaccacctagagccttggatccag
Q07817_BCL2L1-06      cagcttggatggccacttacctgaatgaccacctagagccttggatccag
Q07817_BCL2L1-08      cagcttggatggccacttacctgaatgaccacctagagccttgg------
Q07817_BCL2L1-01      cagcttggatggccacttacctgaatgaccacctagagccttggatccag
Q07817_BCL2L1-03      cagcttggatggccacttacctgaatgaccacctagagccttggatccag
                                                                        

Q07817_BCL2L1-02      acgggc--------------------------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-07      gagaacggcggctgg-----------------------------------
Q07817_BCL2L1-04      gagaacggcggctgggatacttttgtggaactctatgggaacaatgcagc
Q07817_BCL2L1-05      gagaacggcggctgg-----------------------------------
Q07817_BCL2L1-06      gagaacggcggctgg-----------------------------------
Q07817_BCL2L1-08      --------------------------------------------------
Q07817_BCL2L1-01      gagaacggcggctgggatacttttgtggaactctatgggaacaatgcagc
Q07817_BCL2L1-03      gagaacggcggctgggatacttttgtggaactctatgggaacaatgcagc
                                                                        

Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-07      --------------------------------------------------
Q07817_BCL2L1-04      agccgagagccgaaagg---------------------------------
Q07817_BCL2L1-05      --------------------------------------------------
Q07817_BCL2L1-06      --------------------------------------------------
Q07817_BCL2L1-08      --------------------------------------------------
Q07817_BCL2L1-01      agccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgg
Q07817_BCL2L1-03      agccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgg
                                                                        

Q07817_BCL2L1-02      --atgactgtggccggcgtggttctgctgggctcactcttcagtcggaaa
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-07      --------------------------------------------------
Q07817_BCL2L1-04      --------------------------------------------------
Q07817_BCL2L1-05      --------------------------------------------------
Q07817_BCL2L1-06      --------------------------------------------------
Q07817_BCL2L1-08      --------------------------------------------------
Q07817_BCL2L1-01      gcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaa
Q07817_BCL2L1-03      gcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaa
                                                                        

Q07817_BCL2L1-02      tga
Q07817_BCL2L1-09      ---
Q07817_BCL2L1-07      ---
Q07817_BCL2L1-04      ---
Q07817_BCL2L1-05      ---
Q07817_BCL2L1-06      ---
Q07817_BCL2L1-08      ---
Q07817_BCL2L1-01      tga
Q07817_BCL2L1-03      tga
                         

© 1998-2020Legal notice