Dataset for CDS BCL-2-like of organism Sinocyclocheilus grahami

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A672T179_BCL2-01      atggcacaggagaatg---tgtatgataaccgcagtctagtggtgaagta
A0A672K8R2_BCL2L1-      atgt---------------cttactataaccgagaactggtggtattttt
A0A672N8N5_BCL2L1-      atgt---------------cttactataaccgagaactggtggtattttt
A0A672KMK1_MCL1-01      atgttccctgggagtaaagtttcaaacgacagcggcttttggccatgcat
A0A672RP45_MCL1-02      atgt------ggagcgca-tttta-------------------cgtgc--
A0A672RP45_MCL1-01      atgttccctgggagtaaagttttaaacgacaaaggcttttggccatgcat
A0A672RP45_MCL1-03      atgttccctgggagtaaagttttaaacgacaaaggcttttggccatgcat
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      ---------gtccagaagccggcccgtgtg---aggggaggagtttcggg
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      atgtcactgagccccgcattaccccgtgagtcagagggtgaagcttcagt
                                                                          

A0A672T179_BCL2-01      catcc-----------------accataagctctggaagaagggat----
A0A672K8R2_BCL2L1-      tatta-----------------aatacaaactctcgcagaggaactaccc
A0A672N8N5_BCL2L1-      tatta-----------------aatataaactctcacagaggaactaccc
A0A672KMK1_MCL1-01      tggaatagcagctcttaacgtcaacaacagctcgagcgggtttggtcgca
A0A672RP45_MCL1-02      -ggaa--------cctgat--------cagctcgggcgggctgggtcgca
A0A672RP45_MCL1-01      tggaataacagctcttaatgtcaacagcagctcgggcgggctgggtcgca
A0A672RP45_MCL1-03      tggaataacagctcttaatgtcaacagcagctcgggcgggctgggtcgca
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      g---------------------------------------aaatccgtga
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      gctttcacacacgactaatctgagctcagcgctcgctctcacagcttgca
                                                                          

A0A672T179_BCL2-01      ----acgtgtgggaagtgaacggacacgatgacagtgtctcgaatgg---
A0A672K8R2_BCL2L1-      ctacaaccacattgaatttacagaagacacaaatcggactgatgcgg---
A0A672N8N5_BCL2L1-      ctacaatcacattgaatttacagaagacacaaatcggactgatgcgg---
A0A672KMK1_MCL1-01      agccacttgtaatgccagaactgaaagcccagaaccagttcacagggaac
A0A672RP45_MCL1-02      agccactggtaatgccagaactgaaaccccagaaccagtttacagggaac
A0A672RP45_MCL1-01      agccactggtaatgccagaactgaaaccccagaaccagtttacagggaac
A0A672RP45_MCL1-03      agccactggtaatgccagaactgaaaccccagaaccagtttacagggaac
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      cgcagcacgcagcacgcagc------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      cgcagcacgcagcacgcagcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A672T179_BCL2-01      ---------------------------------actgatgatggggaggc
A0A672K8R2_BCL2L1-      -------------------------cggaagggaatgatgatgaggcggc
A0A672N8N5_BCL2L1-      -------------------------cggaagggaatgatgatgaggaggc
A0A672KMK1_MCL1-01      ggtctccagggctcggtaccatcctcgcctgagacggactgcgaggaaat
A0A672RP45_MCL1-02      ggactccagggctcggtaccatcctcgcctgagccggattgcgaggaagt
A0A672RP45_MCL1-01      ggactccagggctcggtaccatcctcgcctgagccggattgcgaggaagt
A0A672RP45_MCL1-03      ggactccagggctcggtaccatcctcgcctgagccggattgcgaggaagt
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      ---------------------------------------------accac
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      nnnnnnnnnnnnnnnntcgtttccgcggcggacggatctctaccgagcac
                                                                          

A0A672T179_BCL2-01      aggagg--------------------------------------------
A0A672K8R2_BCL2L1-      agcaggaatgacgaacctcgttaatggctccctaaacggaacaagtactg
A0A672N8N5_BCL2L1-      agcaggaacgacaaccctcgttaatggctccctgaacggaacaagtactg
A0A672KMK1_MCL1-01      ---agatgattacacctccatctacgccgccctggaaatggacacgcgag
A0A672RP45_MCL1-02      acaagatgaatacacgtccatctacgacgccctggaaatggacacacgag
A0A672RP45_MCL1-01      acaagatgaatacacgtccatctacgacgccctggaaatggacacacgag
A0A672RP45_MCL1-03      acaagatgaatacacgtccatctacgacgccctggaaatggacacacgag
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      accggacccgcaggagctcggttccgccgaactggaccgcgacacgagac
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      accggacccgcaggagctcggttccgccgaactggaccgcgacacgagac
                                                                          

A0A672T179_BCL2-01      --accgcggcggctcccgtcacgacccgtgcagc----------------
A0A672K8R2_BCL2L1-      gttccactgggaccccaccaaggtcccccgcttcaaccccccagcgtcag
A0A672N8N5_BCL2L1-      gttccactgggaccccgccaaggtcccccgcttcaaccccccagcgtcag
A0A672KMK1_MCL1-01      agattattgacgctttcttaaaaagctttacaggactccctcattctaaa
A0A672RP45_MCL1-02      agattattgacattttcttaaaaaacgttactggattccctcattctaaa
A0A672RP45_MCL1-01      agattattgacattttcttaaaaaacgttactggattccctcattctaaa
A0A672RP45_MCL1-03      agattattgacattttcttaaaaaacgttactggattccctcattctaaa
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      agctcttgctggacttctaccgcacgcgcaccggaatgtgtccgcgggac
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      agctcttgctggacttctaccgcacgcgcaccggaatgtgtccgcgggac
                                                                          

A0A672T179_BCL2-01      ---------------gctcttcacacggtgctacgggaggctggggac--
A0A672K8R2_BCL2L1-      acgaacgggactgggggtctggatgctgtaaaggaggcgcttcgcgattc
A0A672N8N5_BCL2L1-      acaaacgggactgggggtctggatgcagtaaaggaggcgcttcgcgattc
A0A672KMK1_MCL1-01      agtgaaaaaacccaggttctgtctacgatgaagcgggttgtggacagtct
A0A672RP45_MCL1-02      agtgggaataaacaggttctggcaacgatgaatcgggttgtggaaagtct
A0A672RP45_MCL1-01      agtgggaataaacaggttctggcaacgatgaatcgggttgtggaaagtct
A0A672RP45_MCL1-03      agtgggaataaacaggttctggcaacgatgaatcgggttgtggaaagtct
A0A672KAT0_MCL1-01      ---------cctgatgatccgacgatagctgctcgcatctcagcttgtct
A0A672PT04_MCL1-02      cggaagctgcatcacgcgctaccgacggtgactcgcgttgtcgcggacgt
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      cggaagctgcatcacgcgctaccgacggtgactcgcgttgtcgcggacgt
                                                                          

A0A672T179_BCL2-01      -------gaactggagcggctttatcagtcggactttgcggagatgtcca
A0A672K8R2_BCL2L1-      tgccaacgagtttgagctgcgttattcccaagcattcaacgacctgtcct
A0A672N8N5_BCL2L1-      tgccaacgagtttgagctgcgttattcccaagcattcaacgacctgtcct
A0A672KMK1_MCL1-01      cgcggtgaagcacgaactg------------gcttacaaaggtatgattg
A0A672RP45_MCL1-02      tgtgatgaagcacgaactg------------gcttacaaaggtatgattg
A0A672RP45_MCL1-01      tgtgatgaagcacgaactg------------gcttacaaaggtatgattg
A0A672RP45_MCL1-03      tgtgatgaagcacgaactg------------gcttacaaaggtatgattg
A0A672KAT0_MCL1-01      at------------atata------------ttttctgcagggatgctgc
A0A672PT04_MCL1-02      tctcgtgaagcacgagatc------------gcgtacaaaggaatgctgc
A0A672K136_MCL1-01      -------------------------------------------atgctgc
A0A672PT04_MCL1-01      tctcgtgaagcacgagatc------------gcgtacaaaggaatgctgc
                                                                    **    

A0A672T179_BCL2-01      aacagctgcatctcacgtccatcacggcgcaccagcgcttcaccgcg---
A0A672K8R2_BCL2L1-      cgcagctccacatcacgcctgccacggcataccagagct---tcgagagc
A0A672N8N5_BCL2L1-      cgcagctccacatcacgcctgccacagcgtaccagagct---tcgagagc
A0A672KMK1_MCL1-01      cacggctgaatctggagcagaaaggagaagatgtgagttttgtcaagact
A0A672RP45_MCL1-02      cacgtctgaatctggagcagaaaggagaagatgtgagtttcgtcaagact
A0A672RP45_MCL1-01      cacgtctgaatctggagcagaaaggagaagatgtgagtttcgtcaagact
A0A672RP45_MCL1-03      cacgtctgaatctggagcagaaaggagaagatgtgagtttcgtcaagact
A0A672KAT0_MCL1-01      agcgtctgcagctggactctcagccggacgacttgagcttcatcggctgt
A0A672PT04_MCL1-02      agcgtctgcagctggaatctcaagcggacgacatgagcttcatcggctgt
A0A672K136_MCL1-01      agcgtctgcagctggaatctcaagcggacgacatgagcttcatcggctgt
A0A672PT04_MCL1-01      agcgtctgcagctggaatctcaagcggacgacatgagcttcatcggctgt
                          *  **  *  *             *   *   * * *    *      

A0A672T179_BCL2-01      gtcatagacgagctgttcagggacggcgtg---aactggggcagaatcat
A0A672K8R2_BCL2L1-      gtgatggatgaggtgttccgcgacggcgtc---aactggggccgcatcgt
A0A672N8N5_BCL2L1-      gtgatggatgaggtgttccgcgacggcgtc---aactggggccgcatcgt
A0A672KMK1_MCL1-01      gtggcaacagaactcttcagcgatggcatcacaaactgggggcgcatttg
A0A672RP45_MCL1-02      gtggcaacagaagtcttcagcgatggcatcacaaactggggtcgcattgc
A0A672RP45_MCL1-01      gtggcaacagaagtcttcagcgatggcatcacaaactggggtcgcattgc
A0A672RP45_MCL1-03      gtggcaacagaagtcttcagcgatggcatcacaaactggggtcgcattgc
A0A672KAT0_MCL1-01      atagcaaagacgatgttcagagatgacaccactaactggggccgggtcgt
A0A672PT04_MCL1-02      atagcagagactatgttcaacgacaacaccaccaactggggccggatcgt
A0A672K136_MCL1-01      atagcagagactatgttcaacgacaacaccaccaactggggccggatcgt
A0A672PT04_MCL1-01      atagcagagactatgttcaacgacaacaccaccaactggggccggatcgt
                         *           * ***   **   *      ********  *  *   

A0A672T179_BCL2-01      cgcttttttcgagtttggagggaccgtttgc-----gtcgaatgcgtgaa
A0A672K8R2_BCL2L1-      gggactgtttgcctttggaggggctctgtgt-----gttgagtgcgtgga
A0A672N8N5_BCL2L1-      gggactgtttgccttcggaggggctctgtgt-----gttgagtgcgtgga
A0A672KMK1_MCL1-01      cagcctgctgacttttggggcaatggtatgcaagcatcaaaatga----t
A0A672RP45_MCL1-02      cagcctgcttgcttttggggcagtggtatgcaagcatcagaatga----t
A0A672RP45_MCL1-01      cagcctgcttgcttttggggcagtggtatgcaagcatcagaatga----t
A0A672RP45_MCL1-03      cagcctgcttgcttttggggcagtggtatgcaagcatcagaatga----t
A0A672KAT0_MCL1-01      gagtctggtggccttcggagctgtggtgtgctcacagctgaaggagctgc
A0A672PT04_MCL1-02      gagtctggtggccttcggggccgtggtgtgctcgcgtctgaaagagctgc
A0A672K136_MCL1-01      gagtctggtggccttcggggccgtggtgtgctcgcgtctgaaagagctgc
A0A672PT04_MCL1-01      gagtctggtggccttcggggccgtggtgtgctcgcgtctgaaagagctgc
                             *  *    ** ** *      * **          *  *      

A0A672T179_BCL2-01      taaggagatgacggtgcatgtggataacatcgcgggctggatgaccgagt
A0A672K8R2_BCL2L1-      gaaggagatgagcccgctagtgggaagcatcgcggaatggatgaccgtct
A0A672N8N5_BCL2L1-      gaaggagatgagcccgctagtgggaagcatcgcggattggatgaccgtct
A0A672KMK1_MCL1-01      agagg-acttggcaagtgtgtgagtctggtgggggaagagatctcttcct
A0A672RP45_MCL1-02      aaagg-acttagcaagtgtgtgagtctggtggggaaagagatctcttcct
A0A672RP45_MCL1-01      aaagg-acttagcaagtgtgtgagtctggtggggaaagagatctcttcct
A0A672RP45_MCL1-03      aaagg-acttagcaagtgtgtgagtctggtggggaaagagatctcttcct
A0A672KAT0_MCL1-01      agagg-g---agc-ggtgcgtggagacggtggcccagctgatctcctctt
A0A672PT04_MCL1-02      agagg-g---agc-ggtgcgtggagacggtggcccagcagatctcctcct
A0A672K136_MCL1-01      agagg-g---agc-ggtgcgtggagacggtggcccagcagatctcctcct
A0A672PT04_MCL1-01      agagg-g---agc-ggtgcgtggagacggtggcccagcagatctcctcct
                          ***          *   ***       * *       ***  *    *

A0A672T179_BCL2-01      atctgaacgggccgctgcacggctggatccaggagaacggcggctgggag
A0A672K8R2_BCL2L1-      acctagacaacaaaattcagccctggatccagagccaaggaggatgg---
A0A672N8N5_BCL2L1-      acctagacaacaaaattcagccctggatccagagccaaggaggatgggaa
A0A672KMK1_MCL1-01      atcttctcacagaccaacgggactggctgctcaaaaacaaagcatgggat
A0A672RP45_MCL1-02      atcttctcacaacccagcgggactggctgctcaaaaacaatgcatgggat
A0A672RP45_MCL1-01      atcttctcacaacccagcgggactggctgctcaaaaacaatgcatgggat
A0A672RP45_MCL1-03      atcttctcacaacccagcgggactggctgctcaaaaacaatgcatgggat
A0A672KAT0_MCL1-01      atctgatctcagaacagcacgactggctgctcaataacaagggctggcat
A0A672PT04_MCL1-02      atctgatctccgatcagcacgactggctgctcaacaacaagggctggcat
A0A672K136_MCL1-01      atctgatctccgatcagcacgactggctgctcaacaacaagggctggcat
A0A672PT04_MCL1-01      atctgatctccgatcagcacgactggctgctcaacaacaagggctggcat
                        * **   *         *    **** * *      *    *  ***   

A0A672T179_BCL2-01      gcgtttgtggagctct---acggcaggcagagggactctgtgtttcgcag
A0A672K8R2_BCL2L1-      ---------------------------------------gtgagtggaaa
A0A672N8N5_BCL2L1-      cgcttcgcagagatctt---tggaaaagatgcagcggcagagagcagaaa
A0A672KMK1_MCL1-01      ggctttgtggaattttttcatgtcccggatacagaggcaactatgagaaa
A0A672RP45_MCL1-02      ggctttgtggaattttttcatgtcccaaatacagaagcggctgtgagaaa
A0A672RP45_MCL1-01      ggctttgtggaattttttcatgtcccaaatacagaagcggctgtgagaaa
A0A672RP45_MCL1-03      ggctttgtggaattttttcatgtcccaaatacagaagcggctgtgagaaa
A0A672KAT0_MCL1-01      gggttcgtggcgttcttccgcgtggaggacatggagtctgtggttcgcag
A0A672PT04_MCL1-02      ggattcgtggagtttttccgcgtggaggatgtggagtctgtgattcgtaa
A0A672K136_MCL1-01      ggattcgtggagtttttccgcgtggaggatgtggagtctgtgattcgtaa
A0A672PT04_MCL1-01      ggattcgtggagtttttccgcgtggaggatgtggagtctgtgattcgtaa
                                                                      * * 

A0A672T179_BCL2-01      ctcgtg---------------------gtcatcgatagtaacggtcttcg
A0A672K8R2_BCL2L1-      gttacttgtatttttc----------tcct----------accctgtt--
A0A672N8N5_BCL2L1-      atcacaagaaaacttcaagaagtggttgctggcgggaatgaccttgctca
A0A672KMK1_MCL1-01      cacatt------------------------------gatggccattggtg
A0A672RP45_MCL1-02      cacatt------------------------------gatggccattggca
A0A672RP45_MCL1-01      cacatt------------------------------gatggccattggca
A0A672RP45_MCL1-03      cacatt------------------------------gatggccattggca
A0A672KAT0_MCL1-01      cgctct------------------------------gatggctgttgtgg
A0A672PT04_MCL1-02      tgcttt------------------------------gatggctgtggtgg
A0A672K136_MCL1-01      tgcttt------------------------------gatggctgtggtgg
A0A672PT04_MCL1-01      tgcttt------------------------------gatggctgtggtgg
                                                                 *  *     

A0A672T179_BCL2-01      gtctagctgcgcttggggccgttggcttgaccataggagcctaccttgct
A0A672K8R2_BCL2L1-      --agtttgaagattaagt--cct--atcggtttggaacaac---------
A0A672N8N5_BCL2L1-      cgggtgtcgtggtcgggtcactc--attgcacagaaacgcc---------
A0A672KMK1_MCL1-01      gtgtggcaacattcggagctgct--cttgcttatatgatac---------
A0A672RP45_MCL1-02      gtgtggctacatttggagctgca--cttgcttatttgatac---------
A0A672RP45_MCL1-01      gtgtggctacatttggagctgca--cttgcttatttgatac---------
A0A672RP45_MCL1-03      gtgtggctacatttggagctgca--cttgcttatttgatac---------
A0A672KAT0_MCL1-01      gatgtgctgggatcggcgccggt--ctcgctctcctgatcc---------
A0A672PT04_MCL1-02      gatgcgctgggatcggcgccggt--ctcgctttcctgatcc---------
A0A672K136_MCL1-01      gatgcgctgggatcggcgccggt--ctcgctttcctgatcc---------
A0A672PT04_MCL1-01      gatgcgctgggatcggcgccggt--ctcgctttcctgatcc---------
                                    *             * *           *         

A0A672T179_BCL2-01      cagaaatga-----------------------------------------
A0A672K8R2_BCL2L1-      -----atga-----------------------------------------
A0A672N8N5_BCL2L1-      ----tgtga-----------------------------------------
A0A672KMK1_MCL1-01      ----ggtga-----------------------------------------
A0A672RP45_MCL1-02      ----ggtga-----------------------------------------
A0A672RP45_MCL1-01      ----ggtga-----------------------------------------
A0A672RP45_MCL1-03      ----ggtcatccgtggggtctaatgaggactatggtaatgacacacacag
A0A672KAT0_MCL1-01      ----gatga-----------------------------------------
A0A672PT04_MCL1-02      ----ggtga-----------------------------------------
A0A672K136_MCL1-01      ----ggtga-----------------------------------------
A0A672PT04_MCL1-01      ----ggtga-----------------------------------------
                              * *                                         

A0A672T179_BCL2-01      --------------------------------------------------
A0A672K8R2_BCL2L1-      --------------------------------------------------
A0A672N8N5_BCL2L1-      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      ggcctcacctgatcctccagctcactgctgcaacacctgctgtggttacc
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
                                                                          

A0A672T179_BCL2-01      --------------------------------------------------
A0A672K8R2_BCL2L1-      --------------------------------------------------
A0A672N8N5_BCL2L1-      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      tgagccaggcggcacatggctgttatactcagtggaatacaagtaaagcc
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
                                                                          

A0A672T179_BCL2-01      ---------------------------------------------
A0A672K8R2_BCL2L1-      ---------------------------------------------
A0A672N8N5_BCL2L1-      ---------------------------------------------
A0A672KMK1_MCL1-01      ---------------------------------------------
A0A672RP45_MCL1-02      ---------------------------------------------
A0A672RP45_MCL1-01      ---------------------------------------------
A0A672RP45_MCL1-03      atgcgacagtacatgtcaagtcaagtcaagtcaccttttatatag
A0A672KAT0_MCL1-01      ---------------------------------------------
A0A672PT04_MCL1-02      ---------------------------------------------
A0A672K136_MCL1-01      ---------------------------------------------
A0A672PT04_MCL1-01      ---------------------------------------------
                                                                     

© 1998-2020Legal notice