Dataset for CDS BCL-2-like of organism Sinocyclocheilus grahami

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A672K136_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=MCL-1 (length=366 residues).
atgctgcagcgtctgcagctggaatctcaagcggacgacatgagcttcatcggctgtatagcagagactatgttcaacga
caacaccaccaactggggccggatcgtgagtctggtggccttcggggccgtggtgtgctcgcgtctgaaagagctgcaga
gggagcggtgcgtggagacggtggcccagcagatctcctcctatctgatctccgatcagcacgactggctgctcaacaac
aagggctggcatggattcgtggagtttttccgcgtggaggatgtggagtctgtgattcgtaatgctttgatggctgtggt
gggatgcgctgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A672K8R2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BCL2L1 (length=654 residues).
atgtcttactataaccgagaactggtggtattttttattaaatacaaactctcgcagaggaactacccctacaaccacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaatgacgaacctcg
ttaatggctccctaaacggaacaagtactggttccactgggaccccaccaaggtcccccgcttcaaccccccagcgtcag
acgaacgggactgggggtctggatgctgtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgttattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacggcataccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgcctttggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccgctagtgggaagcatcgcggaatggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggtgagtggaaagttacttgtatttttctcctaccctgttagtttgaagattaagtcctatcggt
ttggaacaacatga
>gnl|bcl2dbcds|A0A672KAT0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=MCL-1 (length=426 residues).
cctgatgatccgacgatagctgctcgcatctcagcttgtctatatatattttctgcagggatgctgcagcgtctgcagct
ggactctcagccggacgacttgagcttcatcggctgtatagcaaagacgatgttcagagatgacaccactaactggggcc
gggtcgtgagtctggtggccttcggagctgtggtgtgctcacagctgaaggagctgcagagggagcggtgcgtggagacg
gtggcccagctgatctcctcttatctgatctcagaacagcacgactggctgctcaataacaagggctggcatgggttcgt
ggcgttcttccgcgtggaggacatggagtctgtggttcgcagcgctctgatggctgttgtgggatgtgctgggatcggcg
ccggtctcgctctcctgatccgatga
>gnl|bcl2dbcds|A0A672KMK1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=MCL-1 (length=744 residues).
atgttccctgggagtaaagtttcaaacgacagcggcttttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccacttgtaatgccagaactgaaagcccagaaccagttcacagggaacggtctccagg
gctcggtaccatcctcgcctgagacggactgcgaggaaatagatgattacacctccatctacgccgccctggaaatggac
acgcgagagattattgacgctttcttaaaaagctttacaggactccctcattctaaaagtgaaaaaacccaggttctgtc
tacgatgaagcgggttgtggacagtctcgcggtgaagcacgaactggcttacaaaggtatgattgcacggctgaatctgg
agcagaaaggagaagatgtgagttttgtcaagactgtggcaacagaactcttcagcgatggcatcacaaactgggggcgc
atttgcagcctgctgacttttggggcaatggtatgcaagcatcaaaatgatagaggacttggcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacgggactggctgctcaaaaacaaagcatgggatggctttgtgg
aattttttcatgtcccggatacagaggcaactatgagaaacacattgatggccattggtggtgtggcaacattcggagct
gctcttgcttatatgatacggtga
>gnl|bcl2dbcds|A0A672N8N5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BCL2L1 (length=720 residues).
atgtcttactataaccgagaactggtggtattttttattaaatataaactctcacagaggaactacccctacaatcacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggaggcagcaggaacgacaaccctcg
ttaatggctccctgaacggaacaagtactggttccactgggaccccgccaaggtcccccgcttcaaccccccagcgtcag
acaaacgggactgggggtctggatgcagtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgttattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttcggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccgctagtgggaagcatcgcggattggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcagagatctttggaaaagatgcagcggcagagagcagaaaatcacaagaaaact
tcaagaagtggttgctggcgggaatgaccttgctcacgggtgtcgtggtcgggtcactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|A0A672PT04_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=MCL-1 (length=747 residues).
atgtcactgagccccgcattaccccgtgagtcagagggtgaagcttcagtgctttcacacacgactaatctgagctcagc
gctcgctctcacagcttgcacgcagcacgcagcacgcagcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnntcgtttccgcggcggacggatctctaccgagcacaccggacccgcaggagctcggttccgccgaactggaccgc
gacacgagacagctcttgctggacttctaccgcacgcgcaccggaatgtgtccgcgggaccggaagctgcatcacgcgct
accgacggtgactcgcgttgtcgcggacgttctcgtgaagcacgagatcgcgtacaaaggaatgctgcagcgtctgcagc
tggaatctcaagcggacgacatgagcttcatcggctgtatagcagagactatgttcaacgacaacaccaccaactggggc
cggatcgtgagtctggtggccttcggggccgtggtgtgctcgcgtctgaaagagctgcagagggagcggtgcgtggagac
ggtggcccagcagatctcctcctatctgatctccgatcagcacgactggctgctcaacaacaagggctggcatggattcg
tggagtttttccgcgtggaggatgtggagtctgtgattcgtaatgctttgatggctgtggtgggatgcgctgggatcggc
gccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A672PT04_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=MCL-1 (length=621 residues).
gtccagaagccggcccgtgtgaggggaggagtttcggggaaatccgtgacgcagcacgcagcacgcagcaccacaccgga
cccgcaggagctcggttccgccgaactggaccgcgacacgagacagctcttgctggacttctaccgcacgcgcaccggaa
tgtgtccgcgggaccggaagctgcatcacgcgctaccgacggtgactcgcgttgtcgcggacgttctcgtgaagcacgag
atcgcgtacaaaggaatgctgcagcgtctgcagctggaatctcaagcggacgacatgagcttcatcggctgtatagcaga
gactatgttcaacgacaacaccaccaactggggccggatcgtgagtctggtggccttcggggccgtggtgtgctcgcgtc
tgaaagagctgcagagggagcggtgcgtggagacggtggcccagcagatctcctcctatctgatctccgatcagcacgac
tggctgctcaacaacaagggctggcatggattcgtggagtttttccgcgtggaggatgtggagtctgtgattcgtaatgc
tttgatggctgtggtgggatgcgctgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A672RP45_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=MCL-1 (length=747 residues).
atgttccctgggagtaaagttttaaacgacaaaggcttttggccatgcattggaataacagctcttaatgtcaacagcag
ctcgggcgggctgggtcgcaagccactggtaatgccagaactgaaaccccagaaccagtttacagggaacggactccagg
gctcggtaccatcctcgcctgagccggattgcgaggaagtacaagatgaatacacgtccatctacgacgccctggaaatg
gacacacgagagattattgacattttcttaaaaaacgttactggattccctcattctaaaagtgggaataaacaggttct
ggcaacgatgaatcgggttgtggaaagtcttgtgatgaagcacgaactggcttacaaaggtatgattgcacgtctgaatc
tggagcagaaaggagaagatgtgagtttcgtcaagactgtggcaacagaagtcttcagcgatggcatcacaaactggggt
cgcattgccagcctgcttgcttttggggcagtggtatgcaagcatcagaatgataaaggacttagcaagtgtgtgagtct
ggtggggaaagagatctcttcctatcttctcacaacccagcgggactggctgctcaaaaacaatgcatgggatggctttg
tggaattttttcatgtcccaaatacagaagcggctgtgagaaacacattgatggccattggcagtgtggctacatttgga
gctgcacttgcttatttgatacggtga
>gnl|bcl2dbcds|A0A672RP45_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=MCL-1 (length=702 residues).
atgtggagcgcattttacgtgcggaacctgatcagctcgggcgggctgggtcgcaagccactggtaatgccagaactgaa
accccagaaccagtttacagggaacggactccagggctcggtaccatcctcgcctgagccggattgcgaggaagtacaag
atgaatacacgtccatctacgacgccctggaaatggacacacgagagattattgacattttcttaaaaaacgttactgga
ttccctcattctaaaagtgggaataaacaggttctggcaacgatgaatcgggttgtggaaagtcttgtgatgaagcacga
actggcttacaaaggtatgattgcacgtctgaatctggagcagaaaggagaagatgtgagtttcgtcaagactgtggcaa
cagaagtcttcagcgatggcatcacaaactggggtcgcattgccagcctgcttgcttttggggcagtggtatgcaagcat
cagaatgataaaggacttagcaagtgtgtgagtctggtggggaaagagatctcttcctatcttctcacaacccagcggga
ctggctgctcaaaaacaatgcatgggatggctttgtggaattttttcatgtcccaaatacagaagcggctgtgagaaaca
cattgatggccattggcagtgtggctacatttggagctgcacttgcttatttgatacggtga
>gnl|bcl2dbcds|A0A672RP45_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=MCL-1 (length=933 residues).
atgttccctgggagtaaagttttaaacgacaaaggcttttggccatgcattggaataacagctcttaatgtcaacagcag
ctcgggcgggctgggtcgcaagccactggtaatgccagaactgaaaccccagaaccagtttacagggaacggactccagg
gctcggtaccatcctcgcctgagccggattgcgaggaagtacaagatgaatacacgtccatctacgacgccctggaaatg
gacacacgagagattattgacattttcttaaaaaacgttactggattccctcattctaaaagtgggaataaacaggttct
ggcaacgatgaatcgggttgtggaaagtcttgtgatgaagcacgaactggcttacaaaggtatgattgcacgtctgaatc
tggagcagaaaggagaagatgtgagtttcgtcaagactgtggcaacagaagtcttcagcgatggcatcacaaactggggt
cgcattgccagcctgcttgcttttggggcagtggtatgcaagcatcagaatgataaaggacttagcaagtgtgtgagtct
ggtggggaaagagatctcttcctatcttctcacaacccagcgggactggctgctcaaaaacaatgcatgggatggctttg
tggaattttttcatgtcccaaatacagaagcggctgtgagaaacacattgatggccattggcagtgtggctacatttgga
gctgcacttgcttatttgatacggtcatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctga
tcctccagctcactgctgcaacacctgctgtggttacctgagccaggcggcacatggctgttatactcagtggaatacaa
gtaaagccatgcgacagtacatgtcaagtcaagtcaagtcaccttttatatag
>gnl|bcl2dbcds|A0A672T179_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BCL-2 (length=624 residues).
atggcacaggagaatgtgtatgataaccgcagtctagtggtgaagtacatccaccataagctctggaagaagggatacgt
gtgggaagtgaacggacacgatgacagtgtctcgaatggactgatgatggggaggcaggaggaccgcggcggctcccgtc
acgacccgtgcagcgctcttcacacggtgctacgggaggctggggacgaactggagcggctttatcagtcggactttgcg
gagatgtccaaacagctgcatctcacgtccatcacggcgcaccagcgcttcaccgcggtcatagacgagctgttcaggga
cggcgtgaactggggcagaatcatcgcttttttcgagtttggagggaccgtttgcgtcgaatgcgtgaataaggagatga
cggtgcatgtggataacatcgcgggctggatgaccgagtatctgaacgggccgctgcacggctggatccaggagaacggc
ggctgggaggcgtttgtggagctctacggcaggcagagggactctgtgtttcgcagctcgtggtcatcgatagtaacggt
cttcggtctagctgcgcttggggccgttggcttgaccataggagcctaccttgctcagaaatga
© 1998-2020Legal notice