Dataset for CDS BAX of Organism Labrus bergylta

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A3Q3FPB4_BAX-01 BCL2-associated X gene OS=[Eukaryota] Labrus bergylta GN=BAX (length=570 residues).
atgagccttcttaaccagactggaggtgttagtggaccaggagaggtcctctgtgatgtgggtccccaggaacttgaagc
tggagacacgttcaacagccatcccgttgatgtgaatggggttgtgcgtgcttcctctttctctcctgaagtccacgatg
atctccttcgtcttgctggtgttgaggagcaggttgttgtcagcacaccagtattttcttgctgtcatgtcagactcatc
aaccaggttccaggcaactgtgcccggggtatcttcatgaaggtggccagaaacatctttgctgatggcatccactgggg
tcgtgtggtggctctcttccatctggcctacagactcatctacaaggcaataaccagcaaccatgaagagaacatcaaaa
tcatcttcagctgggttcttcaggtcatcagagagcagctccacacctggctcgtacagcagggaggctgggtgggggtg
atccttgggatttctcgttggaggacagtagccatagtagcatcagtagtattagtggcaacttttgtttactgcaggaa
aacacactga
>gnl|bcl2dbcds|A0A3Q3FPB4_BAX-02 BCL2-associated X gene OS=[Eukaryota] Labrus bergylta GN=BAX (length=585 residues).
atgcacagccctcctcctctggtcttaccggagtcctctgctgttctgtctgctcggtgtgtgtggcgaccggctagctt
gatagcatcgtccggtactccgttgtttagccatgtttccgtgaatatcatgacattacagtccataattctcttgctgt
ggatgatgcgaagtcgtaactcgtccattttgttcaccaaagaccgcacattagcgaggaaaatgctgggtaacgggaga
cggtgcggtgttagctttagcttagcccttatacctccgctattttcttgctgtcatgtcagactcatcaaccaggttcc
aggcaactgtgcccggggtatcttcatgaaggtggccagaaacatctttgctgatggcatccactggggtcgtgtggtgg
ctctcttccatctggcctacagactcatctacaaggcaataaccagcaaccatgaagagaacatcaaaatcatcttcagc
tgggttcttcaggtcatcagagagcagctccacacctggctcgtacagcagggaggctgggtgagtgatggatggtctgt
aaggacctgtcagtcatgtgcttaa
>gnl|bcl2dbcds|A0A3Q3G721_BAX-01 BCL2-associated X gene OS=[Eukaryota] Labrus bergylta GN=BAX (length=615 residues).
atggctgatggacgagaagaggagaggagagaagaagaccaggagcttctgggcgcagtgggaggggaagatgtcattga
tgaccccatcgtggatctggctgcagtgctcctcagagggtatgcgattgaaagtataaaggccgaggagcccggtcgac
acgtgtcgcctgaggatctgggaggaaggtcgagtgaacaacaggatccacaagtcaaagaaatggtggaacagctgcta
aagatcactgagctgaacaggaacgccgagctccaacaactcatcaaccaggttctaggcaactgtgcccggggtatctt
cacgaaggtggccagaaacaactttgctgatggcatcaactggggtcgtgtggtggctctcttccatctggcctacagac
tcatctacaaggcgataacaagcaaccatctagagaacatcaaaatcatcttcagctggtttcttcaggtcatcagagag
cagctccacacctggctcgtacagcagggaggctgggagggggtgatccgtgggatttctcgctggaggacagtagccat
agtagcatcagtagtattagtggcaacttttgtttactacaggagaacacgctga
>gnl|bcl2dbcds|A0A3Q3G721_BAX-02 BCL2-associated X gene OS=[Eukaryota] Labrus bergylta GN=BAX (length=570 residues).
atggctgatggacgagaagaggagaggagagaagaagaccaggagcttctgggcgcagtgggaggggaaggtatgtatgc
gattgaaagtataaaggccgaggagcccggtcgacacgtgtcgcctgaggatctgggaggaaggtcgagtgaacaacagg
atccacaagtcaaagaaatggtggaacagctgctaaagatcactgagctgaacaggaacgccgagctccaacaactcatc
aaccaggttctaggcaactgtgcccggggtatcttcacgaaggtggccagaaacaactttgctgatggcatcaactgggg
tcgtgtggtggctctcttccatctggcctacagactcatctacaaggcgataacaagcaaccatctagagaacatcaaaa
tcatcttcagctggtttcttcaggtcatcagagagcagctccacacctggctcgtacagcagggaggctgggagggggtg
atccgtgggatttctcgctggaggacagtagccatagtagcatcagtagtattagtggcaacttttgtttactacaggag
aacacgctga
>gnl|bcl2dbcds|A0A3Q3GJV5_BAX-01 BCL2-associated X gene OS=[Eukaryota] Labrus bergylta GN=BAX (length=579 residues).
atggcatcacacccgggaggaggcgatcaaggcagtactacagatcagatactggaagtgggagctgttttgttaaagga
tttcatctatgagcgggtccggcggcatggagacggcaatgctacagtgacccgggcgcagctgggcggaagtgagctgt
gtgacccgaaccacaagaagctcgcccagtgcctgcagcagatcggcgacgagctcgatgggaatgtagagctccaaagg
atgataaacaattcatcaatcagtcccacaaaagacatgtttgtgaaagtcgccatagagatcttttcagatgggaggtt
caactggggccgggttgtcgccctgttctacttcgcctgtcgccttgtcatcaaagctctcatgacccaagttcctgata
tcatcagaacaataatcaactggaccttggactacctccaggaaaatgtgatcaactggatcagggagcaaggtggctgg
gaggggattcggtcctacttcggcactcccacatggcagaccgtgggagttttcttggctggtgttctcaccactgttct
agtcattcgcaagatgtga
>gnl|bcl2dbcds|A0A3Q3GJV5_BAX-02 BCL2-associated X gene OS=[Eukaryota] Labrus bergylta GN=BAX (length=540 residues).
atggcatcacacccgggaggaggcgatcaaggtaacagttatttcatctatgagcgggtccggcggcatggagacggcaa
tgctacagtgacccgggcgcagctgggcggaagtgagctgtgtgacccgaaccacaagaagctcgcccagtgcctgcagc
agatcggcgacgagctcgatgggaatgtagagctccaaaggatgataaacaattcatcaatcagtcccacaaaagacatg
tttgtgaaagtcgccatagagatcttttcagatgggaggttcaactggggccgggttgtcgccctgttctacttcgcctg
tcgccttgtcatcaaagctctcatgacccaagttcctgatatcatcagaacaataatcaactggaccttggactacctcc
aggaaaatgtgatcaactggatcagggagcaaggtggctgggaggggattcggtcctacttcggcactcccacatggcag
accgtgggagttttcttggctggtgttctcaccactgttctagtcattcgcaagatgtga
>gnl|bcl2dbcds|A0A3Q3N4D1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Labrus bergylta GN=BAX (length=618 residues).
atggctgacggacgagaagaggagacgagagaagaagaccaggagcttctgggcgcagtgggaggggaagatgtcattga
tgaccccatcattgatcagggagcggtggtcctcagagggtatgtgattgaacgtataaacgccgaggagcccggtcgac
acgtgtcgcctgaggatctgggaggaaggtcgagtgaacaacaggatccacaagtcaaagaagtggtggaacagctgcta
aagatcgctgatgagctgaacaggaacgccgagctccaacaactcatcaaccaggttccaggcaactgcgcccagggtat
cttcatgaaggtggccagaaacatctttgctgatggcatcaactggggtcgtgtggtggctctcttccatctggcctaca
gactcatctacaaggcgataacaagcaaccatctagagaacatcaaaatcatcatcagctgggttcttcaggtcatcaga
gagcagctccacacctggctcgtacagcagggaggctgggagggagtgatccgtgggatttctcgctggaggacagtagc
catagtagcatcagtagtattagtggcaacttttgtttactacaggagaacacgctga
© 1998-2023Legal notice