Dataset for CDS BAX of Organism Labrus bergylta

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3GJV5_BAX-01      atg------------gcatcacacccgggaggaggcgatcaaggcagtac
A0A3Q3GJV5_BAX-02      atg------------gcatcacacccgggaggaggcgatcaaggta----
A0A3Q3N4D1_BAX-01      atggctgacggacgagaagaggagacgagagaagaagaccaggagcttct
A0A3Q3G721_BAX-01      atggctgatggacgagaagaggagaggagagaagaagaccaggagcttct
A0A3Q3G721_BAX-02      atggctgatggacgagaagaggagaggagagaagaagaccaggagcttct
A0A3Q3FPB4_BAX-01      atg---------------------------------------agccttct
A0A3Q3FPB4_BAX-02      atg------------------------------------cacagccctcc
                       ***                                               

A0A3Q3GJV5_BAX-01      tacagatcagatactggaagtgggagctgttttgttaaag-gatttcatc
A0A3Q3GJV5_BAX-02      -acagtt-----------------------------------atttcatc
A0A3Q3N4D1_BAX-01      gggcgcagtgggaggggaa----------------------gatgtcatt
A0A3Q3G721_BAX-01      gggcgcagtgggaggggaa----------------------gatgtcatt
A0A3Q3G721_BAX-02      gggcgcagtgggaggggaa----------------------ggtat----
A0A3Q3FPB4_BAX-01      taaccag-----actgga-----------------------ggtgttagt
A0A3Q3FPB4_BAX-02      tcctctggtcttaccggagtcctctgctgttctgtctgctcggtgtgtgt
                                                                  * *    

A0A3Q3GJV5_BAX-01      tatgagcg---------------------ggtccggcg--------gcat
A0A3Q3GJV5_BAX-02      tatgagcg---------------------ggtccggcg--------gcat
A0A3Q3N4D1_BAX-01      gatgaccccatcattgatcagggagcggtggtcctcag-----agggtat
A0A3Q3G721_BAX-01      gatgaccccatcgtggatctggctgcagtgctcctcag-----agggtat
A0A3Q3G721_BAX-02      ----------------------------------------------gtat
A0A3Q3FPB4_BAX-01      g--gaccag-------gaga---------ggtcctctgtgatgtgg----
A0A3Q3FPB4_BAX-02      ggcgaccggctagcttgatagcatcgtccggtactccgttgtttagccat
                                                                         

A0A3Q3GJV5_BAX-01      ggagacggcaatgcta-----cagtgacccgggcgc--------------
A0A3Q3GJV5_BAX-02      ggagacggcaatgcta-----cagtgacccgggcgc--------------
A0A3Q3N4D1_BAX-01      gtgattgaacgtataaacgccgaggagcccggtcgacacgtgtcgcctga
A0A3Q3G721_BAX-01      gcgattgaaagtataaaggccgaggagcccggtcgacacgtgtcgcctga
A0A3Q3G721_BAX-02      gcgattgaaagtataaaggccgaggagcccggtcgacacgtgtcgcctga
A0A3Q3FPB4_BAX-01      gtccccaggaacttgaag--ctggagacacgttcaacagccat--cccgt
A0A3Q3FPB4_BAX-02      gtttccgtgaatatca-----tgacattacagtccata---at--tctct
                       *              *             *   *                

A0A3Q3GJV5_BAX-01      --agctgggcggaagtgagctgtg-------------tgaccc----gaa
A0A3Q3GJV5_BAX-02      --agctgggcggaagtgagctgtg-------------tgaccc----gaa
A0A3Q3N4D1_BAX-01      ggatctgggagg---aaggtcgag-------------tgaacaacaggat
A0A3Q3G721_BAX-01      ggatctgggagg---aaggtcgag-------------tgaacaacaggat
A0A3Q3G721_BAX-02      ggatctgggagg---aaggtcgag-------------tgaacaacaggat
A0A3Q3FPB4_BAX-01      tgatgtgaat-----ggggttgtgcgtgcttcctctttctctcctgaagt
A0A3Q3FPB4_BAX-02      tgctgtggatgatgcgaagtcgtaact-cgtccattttgttcaccaaaga
                            **           *  *               *            

A0A3Q3GJV5_BAX-01      ccaca----------------agaagctcgcccagtgcctgcagcagatc
A0A3Q3GJV5_BAX-02      ccaca----------------agaagctcgcccagtgcctgcagcagatc
A0A3Q3N4D1_BAX-01      ccaca-----------agtcaaagaagtggtggaacagctgctaaagatc
A0A3Q3G721_BAX-01      ccaca-----------agtcaaagaaatggtggaacagctgctaaagatc
A0A3Q3G721_BAX-02      ccaca-----------agtcaaagaaatggtggaacagctgctaaagatc
A0A3Q3FPB4_BAX-01      ccacgatgatctccttcgtcttgctggtgttgaggagcagg-------tt
A0A3Q3FPB4_BAX-02      ccgca-------cattagcgaggaaaatgctgggtaacgggagacggtgc
                       ** *                       *            *         

A0A3Q3GJV5_BAX-01      ggcgacgagctcgatgggaatgtaga--gctccaaag---------gatg
A0A3Q3GJV5_BAX-02      ggcgacgagctcgatgggaatgtaga--gctccaaag---------gatg
A0A3Q3N4D1_BAX-01      gctgatgagctgaacaggaacgccga--gctccaaca-------------
A0A3Q3G721_BAX-01      ac---tgagctgaacaggaacgccga--gctccaaca-------------
A0A3Q3G721_BAX-02      ac---tgagctgaacaggaacgccga--gctccaaca-------------
A0A3Q3FPB4_BAX-01      gttg-tcagc------------------acaccagtattttcttgctgtc
A0A3Q3FPB4_BAX-02      ggtg-ttagctttagcttagcccttatacctccgctattttcttgctgtc
                              ***                   * **                 

A0A3Q3GJV5_BAX-01      ataaacaattcatcaatca-gtcccacaaaa----------gacatgttt
A0A3Q3GJV5_BAX-02      ataaacaattcatcaatca-gtcccacaaaa----------gacatgttt
A0A3Q3N4D1_BAX-01      -------actcatcaaccaggttccaggcaactgcgcccagggtatcttc
A0A3Q3G721_BAX-01      -------actcatcaaccaggttctaggcaactgtgcccggggtatcttc
A0A3Q3G721_BAX-02      -------actcatcaaccaggttctaggcaactgtgcccggggtatcttc
A0A3Q3FPB4_BAX-01      atgtcagactcatcaaccaggttccaggcaactgtgcccggggtatcttc
A0A3Q3FPB4_BAX-02      atgtcagactcatcaaccaggttccaggcaactgtgcccggggtatcttc
                              * ******* ** ** * *   **          *  ** ** 

A0A3Q3GJV5_BAX-01      gtgaaagtcgccatagagatcttttcagatgggaggttcaactggggccg
A0A3Q3GJV5_BAX-02      gtgaaagtcgccatagagatcttttcagatgggaggttcaactggggccg
A0A3Q3N4D1_BAX-01      atgaaggtggccagaaacatctttgctgatggca---tcaactggggtcg
A0A3Q3G721_BAX-01      acgaaggtggccagaaacaactttgctgatggca---tcaactggggtcg
A0A3Q3G721_BAX-02      acgaaggtggccagaaacaactttgctgatggca---tcaactggggtcg
A0A3Q3FPB4_BAX-01      atgaaggtggccagaaacatctttgctgatggca---tccactggggtcg
A0A3Q3FPB4_BAX-02      atgaaggtggccagaaacatctttgctgatggca---tccactggggtcg
                         *** ** **** * * * **** * ***** *   ** ******* **

A0A3Q3GJV5_BAX-01      ggttgtcgccctgttctacttcgcctgtcgccttgtcatcaaagctctca
A0A3Q3GJV5_BAX-02      ggttgtcgccctgttctacttcgcctgtcgccttgtcatcaaagctctca
A0A3Q3N4D1_BAX-01      tgtggtggctctcttccatctggcctacagactcatctacaaggcgataa
A0A3Q3G721_BAX-01      tgtggtggctctcttccatctggcctacagactcatctacaaggcgataa
A0A3Q3G721_BAX-02      tgtggtggctctcttccatctggcctacagactcatctacaaggcgataa
A0A3Q3FPB4_BAX-01      tgtggtggctctcttccatctggcctacagactcatctacaaggcaataa
A0A3Q3FPB4_BAX-02      tgtggtggctctcttccatctggcctacagactcatctacaaggcaataa
                        ** ** ** ** *** *  * ****   * **  **  *** **  * *

A0A3Q3GJV5_BAX-01      tgacccaagttcctgatatcatcagaacaataatcaactggaccttggac
A0A3Q3GJV5_BAX-02      tgacccaagttcctgatatcatcagaacaataatcaactggaccttggac
A0A3Q3N4D1_BAX-01      caagcaaccatctagagaacatcaaaatcatcatcagctgggttcttcag
A0A3Q3G721_BAX-01      caagcaaccatctagagaacatcaaaatcatcttcagctggtttcttcag
A0A3Q3G721_BAX-02      caagcaaccatctagagaacatcaaaatcatcttcagctggtttcttcag
A0A3Q3FPB4_BAX-01      ccagcaaccatgaagagaacatcaaaatcatcttcagctgggttcttcag
A0A3Q3FPB4_BAX-02      ccagcaaccatgaagagaacatcaaaatcatcttcagctgggttcttcag
                         * * *   *   ** * ***** **  **  *** ****    *  * 

A0A3Q3GJV5_BAX-01      tacctccaggaaaatgtgatcaactggatcagggagcaaggtggctggga
A0A3Q3GJV5_BAX-02      tacctccaggaaaatgtgatcaactggatcagggagcaaggtggctggga
A0A3Q3N4D1_BAX-01      gtcatcagagagcagctccacacctggctcgtacagcagggaggctggga
A0A3Q3G721_BAX-01      gtcatcagagagcagctccacacctggctcgtacagcagggaggctggga
A0A3Q3G721_BAX-02      gtcatcagagagcagctccacacctggctcgtacagcagggaggctggga
A0A3Q3FPB4_BAX-01      gtcatcagagagcagctccacacctggctcgtacagcagggaggctgggt
A0A3Q3FPB4_BAX-02      gtcatcagagagcagctccacacctggctcgtacagcagggaggctgggt
                         * **   **  *  *   ** **** **    **** ** ******* 

A0A3Q3GJV5_BAX-01      ggggattcggtcctacttcggcactcccacatggcagaccgtgggagttt
A0A3Q3GJV5_BAX-02      ggggattcggtcctacttcggcactcccacatggcagaccgtgggagttt
A0A3Q3N4D1_BAX-01      gggagt--gatcc----gtgggatttctcgctggaggacagtagccatag
A0A3Q3G721_BAX-01      gggggt--gatcc----gtgggatttctcgctggaggacagtagccatag
A0A3Q3G721_BAX-02      gggggt--gatcc----gtgggatttctcgctggaggacagtagccatag
A0A3Q3FPB4_BAX-01      gggggt--gatcc----ttgggatttctcgttggaggacagtagccatag
A0A3Q3FPB4_BAX-02      --gagt--gat---------ggatggtctgt--aaggacc----------
                         *  *  * *         * *             ***           

A0A3Q3GJV5_BAX-01      tcttggctggtgttctcaccactgttctagtcattcgcaagatg------
A0A3Q3GJV5_BAX-02      tcttggctggtgttctcaccactgttctagtcattcgcaagatg------
A0A3Q3N4D1_BAX-01      tagcatcagtagtattagtggcaacttttgtttactacaggagaacacgc
A0A3Q3G721_BAX-01      tagcatcagtagtattagtggcaacttttgtttactacaggagaacacgc
A0A3Q3G721_BAX-02      tagcatcagtagtattagtggcaacttttgtttactacaggagaacacgc
A0A3Q3FPB4_BAX-01      tagcatcagtagtattagtggcaacttttgtttactgcaggaaaacacac
A0A3Q3FPB4_BAX-02      ---tgtcagt--------------catgtgctta----------------
                             * *                    *                    

A0A3Q3GJV5_BAX-01      tga
A0A3Q3GJV5_BAX-02      tga
A0A3Q3N4D1_BAX-01      tga
A0A3Q3G721_BAX-01      tga
A0A3Q3G721_BAX-02      tga
A0A3Q3FPB4_BAX-01      tga
A0A3Q3FPB4_BAX-02      --a
                         *

© 1998-2023Legal notice