Dataset for CDS BOK of Organism Lates calcarifer

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W6DRR9_BOK-01      atggaggtcctacggaggtcttctgtgtttgcagcagaggtcctggatgt
A0A4W6DD17_BOK-01      atggagatgttgcgccgctcctctgtgtttgcggccgaa---------gt
A0A4W6DD17_BOK-02      atggagatgttgcgccgctcctctgtgtttgcggccgaa---------gt
                       ****** *  * **  * ** *********** ** **          **

A0A4W6DRR9_BOK-01      gtttgaccggtcgttgaccgagaaggagctggtgtcccagtccaaagcct
A0A4W6DD17_BOK-01      gtttgaccgatcgcccaccgacaaggagctggtgtcccaggccaaggcac
A0A4W6DD17_BOK-02      gtttgaccgatcgcccaccgacaaggagctggtgtcccaggccaaggcac
                       ********* ***   ***** ****************** **** **  

A0A4W6DRR9_BOK-01      tgtgcagagactacattctgtccagactcaaccagaacgggctgggatgg
A0A4W6DD17_BOK-01      tatgcagggactacatccattccaggctgaaccgtgccggcataggctgg
A0A4W6DD17_BOK-02      tatgcagggactacatccattccaggctgaaccgtgccggcataggctgg
                       * ***** ******** *  ***** ** ****    ***  * ** ***

A0A4W6DRR9_BOK-01      tccaaaactgagctcaacctctctccctcgaacgcagcacttgctgaggt
A0A4W6DD17_BOK-01      tctaaccctgaacacggactgtcagcatcaggtggagcactgggagagat
A0A4W6DD17_BOK-02      tctaaccctgaacacggactgtcagcatcaggtggagcactgggagagat
                       ** **  **** * *   ** **  * **    * ****** *  *** *

A0A4W6DRR9_BOK-01      gtcctcggtgcttctctgtctcggcgacgagctggagtgtatacagccca
A0A4W6DD17_BOK-01      atcctcggttctgctgtggctgggcgatgagttggagtaccttcgaccca
A0A4W6DD17_BOK-02      atcctcggttctgctgtggctgggcgatgagttggagtaccttcgaccca
                        ******** ** ** ** ** ***** *** ******   * *  ****

A0A4W6DRR9_BOK-01      gtttgttcaggaacgtggcgcggcagctcaacgtctctgttgccatggag
A0A4W6DD17_BOK-01      acgtttaccgcaatgtagcacgacaactaaacatcacagtggcatcagag
A0A4W6DD17_BOK-02      acgtttaccgcaatgtagcacgacaactaaacatcacagtggcatcagag
                          * * * * ** ** ** ** ** ** *** ** * ** **    ***

A0A4W6DRR9_BOK-01      aacatggtttcggatgccttcatcggcgtggcaacagagatcttttcaa-
A0A4W6DD17_BOK-01      agcgtggtgtctgatgccttcctggctgtagctgcagacattttctccac
A0A4W6DD17_BOK-02      agcgtggtgtctgatgccttcctggctgtagctgcagacattttctcca-
                       * * **** ** ********* * *  ** **  **** ** ** ** * 

A0A4W6DRR9_BOK-01      -----------------caggtataacatggggcaaggtggtagccatgt
A0A4W6DD17_BOK-01      aggtaggtacaggcatgcaggtgtaacatggggaaaggtggtgtctttgt
A0A4W6DD17_BOK-02      -----------------caggtgtaacatggggaaaggtggtgtctttgt
                                        ***** ********** ********  *  ***

A0A4W6DRR9_BOK-01      atgcggtagctggagccctggcagtggactgtgtccgacaaggacatcca
A0A4W6DD17_BOK-01      acgctgtggcaggggccttggcagtggactgtgtacgccatggtcatcca
A0A4W6DD17_BOK-02      acgctgtggcaggggccttggcagtggactgtgtacgccatggtcatcca
                       * ** ** ** ** *** **************** ** ** ** ******

A0A4W6DRR9_BOK-01      acaactgttcacattgtggtggacagtctgggacagtttgtccgcaagtt
A0A4W6DD17_BOK-01      gccatggttcataccatcgtcgactgcatgggggagtttgtccgcaagag
A0A4W6DD17_BOK-02      gccatggttcataccatcgtcgactgcatgggggagtttgtccgcaagag
                        * *  ***** *   * ** *** *  ****  **************  

A0A4W6DRR9_BOK-01      cctggttccctggctgaagagacggggaggatgggcggagatcacgaaat
A0A4W6DD17_BOK-01      tctgacgtcctggttaaaaaggagagggggctgggtggatgtcacaaaat
A0A4W6DD17_BOK-02      tctgacgtcctggttaaaaaggagagggggctgggtggatgtcacaaaat
                        ***    ***** * ** **  * ** ** **** ***  **** ****

A0A4W6DRR9_BOK-01      gtgtgataaagaaggatctgacccctgaacatcactggctgtcctctgtc
A0A4W6DD17_BOK-01      gtgtggtgaacactgatcccagcttccgctctcactggctggtgactgct
A0A4W6DD17_BOK-02      gtgtggtgaacactgatcccagcttccgctctcactggctggtgactgct
                       ***** * ** *  ****  * *        **********    ***  

A0A4W6DRR9_BOK-01      gtcgagtccctgaagtacttcctca---ccacgatgtatgtctacatcat
A0A4W6DD17_BOK-01      gcctgtgcctttggacactatctgaaggccatggtgt---tatacctcct
A0A4W6DD17_BOK-02      gcctgtgcctttggacactatctgaaggccatggtgt---tatacctcct
                       * *    ** *     ***  ** *   *** * ***   * *** ** *

A0A4W6DRR9_BOK-01      gaaggagccgtga
A0A4W6DD17_BOK-01      cagggagaagtga
A0A4W6DD17_BOK-02      cagggagaagtga
                        * ****  ****

© 1998-2023Legal notice