Dataset for CDS BAK1 of Organism Anas zonorhyncha

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9U3X5_BAK1-01      atggtctggggttgggtttctaatttttttttttttttttcggtctctct
A0A8B9U3X5_BAK1-02      atggtctggggttgggtttctaatttttttttttttttttcggtctctct
                        **************************************************

A0A8B9U3X5_BAK1-01      tcttcttttccctcctcctccccggccctgctcgcttccttcccccgcgc
A0A8B9U3X5_BAK1-02      tcttcttttccctcctcctccccggccctgctcgcttccttcccccgcgc
                        **************************************************

A0A8B9U3X5_BAK1-01      cgcgccgctgcgctccggggaggaggcaggaagggagcggcggggatggg
A0A8B9U3X5_BAK1-02      cgcgccgctgcgctccggggaggaggcaggaagggagcggcggggatggg
                        **************************************************

A0A8B9U3X5_BAK1-01      gcagctccccggagggatgcgttagggctccccgggaccccccccggccc
A0A8B9U3X5_BAK1-02      gcagctccccggagggatgcgttagggctccccgggaccccccccggccc
                        **************************************************

A0A8B9U3X5_BAK1-01      ccctggaccccgccgggagccggtaaagctgatcctccccagcatctctg
A0A8B9U3X5_BAK1-02      ccctggaccccgccgggagccggtaaagctgatcctccccagcatctctg
                        **************************************************

A0A8B9U3X5_BAK1-01      cgatggcctcagggaacgacggagacccaccgagggcccacggacgccgg
A0A8B9U3X5_BAK1-02      cgatggcctcagggaacgacggagacccaccgagggcccacggacgccgg
                        **************************************************

A0A8B9U3X5_BAK1-01      ggcagcaatgggcgcagactgtcacaagagctcaattcagaagaccaggt
A0A8B9U3X5_BAK1-02      ggcagcaatgggcgcagactgtcacaagagctcaattcagaagaccaggt
                        **************************************************

A0A8B9U3X5_BAK1-01      ggctcaggaaaccgaggaggtgtttcggagctacgccttctaccgctacc
A0A8B9U3X5_BAK1-02      ggctcaggaaaccgaggaggtgtttcggagctacgccttctaccgctacc
                        **************************************************

A0A8B9U3X5_BAK1-01      aacaggagagagaagagagcggggaagaagtgcccttggacccggagatt
A0A8B9U3X5_BAK1-02      aacaggagagagaagagagcggggaagaagtgcccttggacccggagatt
                        **************************************************

A0A8B9U3X5_BAK1-01      gcggagatccagcaagacctgggcagtaccgggagcctggtggggaggcg
A0A8B9U3X5_BAK1-02      gcggagatccagcaagacctgggcagtaccgggagcctggtggggaggcg
                        **************************************************

A0A8B9U3X5_BAK1-01      cctggccatcatcggcgatgacattaacaagcggtacgacgctgagtttc
A0A8B9U3X5_BAK1-02      cctggccatcatcggcgatgacattaacaagcggtacgacgctgagtttc
                        **************************************************

A0A8B9U3X5_BAK1-01      gctacatgctgaaatccttgcagctcaccaaggagaatgcctacgattac
A0A8B9U3X5_BAK1-02      gctacatgctgaaatccttgcagctcaccaaggagaatgcctacgattac
                        **************************************************

A0A8B9U3X5_BAK1-01      ttcatcaagattgcctccagcctgtttgaaagcggcattaactggggccg
A0A8B9U3X5_BAK1-02      ttcatcaagattgcctccagcctgtttgaaagcggcattaactggggccg
                        **************************************************

A0A8B9U3X5_BAK1-01      ggtgatcgcgctgctgggcttcggctactgcatggccatccacgtctacc
A0A8B9U3X5_BAK1-02      ggtgatcgcgctgctgggcttcggctactgcatggccatccacgtctacc
                        **************************************************

A0A8B9U3X5_BAK1-01      agcacggcataacaggcttcctccgccgcatcgcccgctacgtgacggag
A0A8B9U3X5_BAK1-02      agcacggcataacaggcttcctccgccgcatcgcccgctacgtgacggag
                        **************************************************

A0A8B9U3X5_BAK1-01      ttcatgctgcgcaaccgcatcgcccagtggatcgcccagcagggaggatg
A0A8B9U3X5_BAK1-02      ttcatgctgcgcaaccgcatcgcccagtggatcgcccagcagggaggatg
                        **************************************************

A0A8B9U3X5_BAK1-01      ggtg-------------gctgcactcgatctggacaatgtttacatgaag
A0A8B9U3X5_BAK1-02      ggtgagccaggggggtcacggcttgtgccctgggggacctggggggcaag
                        ****              * **    *  ****   *  *       ***

A0A8B9U3X5_BAK1-01      tacatgctggcggt------ggtggccctggtgatggtggggcatttagt
A0A8B9U3X5_BAK1-02      gggaggctgatgggctccgaggtgcagctgaggttggtggggccggcagc
                           * ****  **       ****   ***  * *********    ** 

A0A8B9U3X5_BAK1-01      ggtgactataaggcttgaaactg------------------------tga
A0A8B9U3X5_BAK1-02      gtgggc---agagcaggaggccggcccaggcagggtgcaggcaggtctaa
                        *  * *   *  **  **  * *                        * *

A0A8B9U3X5_BAK1-01      ctggccctgtctga
A0A8B9U3X5_BAK1-02      cgccccctg-ctaa
                        *   ***** ** *

© 1998-2023Legal notice