Dataset for CDS BAK1 of Organism Anas zonorhyncha

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8B9U3X5_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Anas zonorhyncha GN=BAK1 (length=921 residues).
atggtctggggttgggtttctaatttttttttttttttttcggtctctcttcttcttttccctcctcctccccggccctg
ctcgcttccttcccccgcgccgcgccgctgcgctccggggaggaggcaggaagggagcggcggggatggggcagctcccc
ggagggatgcgttagggctccccgggaccccccccggcccccctggaccccgccgggagccggtaaagctgatcctcccc
agcatctctgcgatggcctcagggaacgacggagacccaccgagggcccacggacgccggggcagcaatgggcgcagact
gtcacaagagctcaattcagaagaccaggtggctcaggaaaccgaggaggtgtttcggagctacgccttctaccgctacc
aacaggagagagaagagagcggggaagaagtgcccttggacccggagattgcggagatccagcaagacctgggcagtacc
gggagcctggtggggaggcgcctggccatcatcggcgatgacattaacaagcggtacgacgctgagtttcgctacatgct
gaaatccttgcagctcaccaaggagaatgcctacgattacttcatcaagattgcctccagcctgtttgaaagcggcatta
actggggccgggtgatcgcgctgctgggcttcggctactgcatggccatccacgtctaccagcacggcataacaggcttc
ctccgccgcatcgcccgctacgtgacggagttcatgctgcgcaaccgcatcgcccagtggatcgcccagcagggaggatg
ggtggctgcactcgatctggacaatgtttacatgaagtacatgctggcggtggtggccctggtgatggtggggcatttag
tggtgactataaggcttgaaactgtgactggccctgtctga
>gnl|bcl2dbcds|A0A8B9U3X5_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Anas zonorhyncha GN=BAK1 (length=960 residues).
atggtctggggttgggtttctaatttttttttttttttttcggtctctcttcttcttttccctcctcctccccggccctg
ctcgcttccttcccccgcgccgcgccgctgcgctccggggaggaggcaggaagggagcggcggggatggggcagctcccc
ggagggatgcgttagggctccccgggaccccccccggcccccctggaccccgccgggagccggtaaagctgatcctcccc
agcatctctgcgatggcctcagggaacgacggagacccaccgagggcccacggacgccggggcagcaatgggcgcagact
gtcacaagagctcaattcagaagaccaggtggctcaggaaaccgaggaggtgtttcggagctacgccttctaccgctacc
aacaggagagagaagagagcggggaagaagtgcccttggacccggagattgcggagatccagcaagacctgggcagtacc
gggagcctggtggggaggcgcctggccatcatcggcgatgacattaacaagcggtacgacgctgagtttcgctacatgct
gaaatccttgcagctcaccaaggagaatgcctacgattacttcatcaagattgcctccagcctgtttgaaagcggcatta
actggggccgggtgatcgcgctgctgggcttcggctactgcatggccatccacgtctaccagcacggcataacaggcttc
ctccgccgcatcgcccgctacgtgacggagttcatgctgcgcaaccgcatcgcccagtggatcgcccagcagggaggatg
ggtgagccaggggggtcacggcttgtgccctgggggacctggggggcaaggggaggctgatgggctccgaggtgcagctg
aggttggtggggccggcagcgtgggcagagcaggaggccggcccaggcagggtgcaggcaggtctaacgccccctgctaa
© 1998-2023Legal notice