Dataset for CDS BCL-2-like of organism Danio rerio

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q568W5_MCL1-01      atgttc-----------gctggaagaaacaacgacaacggcttttggccatgcactgg--
Q8UWD6_MCL1-01      atgttc-----------gctggaagaaacaacgacaacggcttttggccatgcactgg--
Q568V1_MCL1-01      ------------------------------------atgagctt---cctcgcgcagggc
Q9I9N3_MCL1-01      atggctctgagtttggattttaggcgaacggccacgatgagctt---cttcgcgcagggc
                                                        * *   **   *   ** * **  

Q568W5_MCL1-01      ------attacaaagcaaaccactggttattcca----gaactgaaagcgcataaccagt
Q8UWD6_MCL1-01      ------attacaaagcaaaccactggttattcca----gaactgaaagcgcataaccagt
Q568V1_MCL1-01      gttcaaactccgacgctgaagac--gtgcgtcgaagacgaactggacgggtacattgagg
Q9I9N3_MCL1-01      gttcaaactccgacgctaaagac--gtgcgtcgaagacgaactggacggatacactgagg
                          * * * * **  *  **  **   ** *    ****** * *   * *   ** 

Q568W5_MCL1-01      ttgcggtggactctctccag-------ggctcggtac---cgtcct--------cgcctt
Q8UWD6_MCL1-01      ttgcggtggactctctccag-------ggctcggtac---cgtcct--------cgcctt
Q568V1_MCL1-01      aggaggaggcgcctctgaagcggcttagacctggtacaaacggcctgaaggggctgcagc
Q9I9N3_MCL1-01      aggaggaggcgcctctgaagcggcttagaccgggtacaaacggcctgaaggggctgcagc
                      * ** **   ****  **       * *  *****   ** ***         **   

Q568W5_MCL1-01      cggacga---------------aacgggggattatccccccaccgcccttgacatgga--
Q8UWD6_MCL1-01      cggacga---------------aacgggggattatccccccaccgcccttgacatgga--
Q568V1_MCL1-01      tggacggtcgatttgtttctacgacagacggatctctaccgaccaccccagatccagagg
Q9I9N3_MCL1-01      tggacggtcgatttgtttctgcgacagacggatctctaccgaccaccccagatccggagg
                     *****                 ** *  *  * **  ** *** ***  **    **  

Q568W5_MCL1-01      --------cacgcggga---------gattattgacactttcttaataatctttacagga
Q8UWD6_MCL1-01      --------cacgcggga---------gattattgacactttcttaaaaatctttacagga
Q568V1_MCL1-01      agctcgactacgccgaactggaacgcgatactcggcagctcttattggatttttaccgca
Q9I9N3_MCL1-01      agctcgactacgccgaactggaacgcgatactcggcagctcttattggatttttaccgca
                             **** * *         ***  * * **  *  *     ** ***** * *

Q568W5_MCL1-01      ctccc-----------tcattctaaaagtggacgaaaacaagtactgtcaacaatgaggc
Q8UWD6_MCL1-01      ctccc-----------tcattctaaaagtggacgaaaacaagtactgtcaacaatgaggc
Q568V1_MCL1-01      cacacacgggaatgtgtccggtagaccgtaaactccatcacgccataccgacgatgaagc
Q9I9N3_MCL1-01      cacacacgggaatgtgtccggtagaccgtaaactccatcacgccataccgacgatgaagc
                    * * *           **      *  **  **   * ** *   *  * ** **** **

Q568W5_MCL1-01      gggttgtggacaatctcgcggtgaagcacgagctcgcttacaaaggtatgattgcacggc
Q8UWD6_MCL1-01      gggttgtggacaatctcgcggtgaagcacgagctcgcttacaaaggtatgattgcacggc
Q568V1_MCL1-01      gggtggtcgacaatattctcgtgaagcaccagatcgcatacaaaggaatgatccagcgtc
Q9I9N3_MCL1-01      gagtggtcgacaatattctcgtgaagcaccagatcgcatacaaaggaatgatccagcgtc
                    * ** ** ****** *    ********* ** **** ******** *****    ** *

Q568W5_MCL1-01      tgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctct
Q8UWD6_MCL1-01      tgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctct
Q568V1_MCL1-01      ttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatgt
Q9I9N3_MCL1-01      ttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatgt
                    *  * *****     *    *    * *    *******      * ****      * *

Q568W5_MCL1-01      ttagcgatggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgc
Q8UWD6_MCL1-01      ttagcgatggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgc
Q568V1_MCL1-01      ttaaagatggcgtcactaactggggccgaatcgcgagtctggtggcgttcggggccgtgg
Q9I9N3_MCL1-01      ttaaagatggcgtcactaactggggccgaatcgcgagtctggtggcgttcggggccgtgg
                    ***  ******  *** ******** ** ** ** ** *** ** * ** *****  ** 

Q568W5_MCL1-01      tgtgcaaataccagaatgacagag----gacatagcaagtatgtgaggttggtaggggag
Q8UWD6_MCL1-01      tgtgcaaataccagaatgacagag----gacatagcaagtatgtgaggttggtaggggag
Q568V1_MCL1-01      tttgc----tctcgattgaaggagctccagcaggatcagtgtgtggagagagtggctgag
Q9I9N3_MCL1-01      tttgc----tctcgattgaaggagctccagcaggatcagtgtgtggagagggtggctgag
                    * ***     *  ** ***  ***      **     *** ****  *   ** *  ***

Q568W5_MCL1-01      gagatctcgtcttatctacttacagagcagcgggactggatactcagaaacaaagcatgg
Q8UWD6_MCL1-01      gagatctcgtcttatctacttacagagcagcgggactggatactcagaaacaaagcatgg
Q568V1_MCL1-01      cagatctcctcatatctgacctcagaacagcaggactggatcctcaaaaacaagagctgt
Q9I9N3_MCL1-01      cagatctcctcatatctgacctcagaacagcaggactggatcctcaaaaacaagagctgg
                     ******* ** *****     **** **** ********* **** ******    ** 

Q568W5_MCL1-01      gatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacactt
Q8UWD6_MCL1-01      gatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacactt
Q568V1_MCL1-01      catgggttcgtggagtttttccaccaggaggacgtagagtctgttgtccgtcatggtctg
Q9I9N3_MCL1-01      catgggtttgtggagtttttccaccaggaggatgtagagtctgttgtccgtcatggtctt
                     **** ** *********** **      ***   **** * * ***  *  *    ** 

Q568W5_MCL1-01      ctaacaattggtgg-tgtggctacattaagtgcagcacttgcctattggatacggtga
Q8UWD6_MCL1-01      ctaacaattggtag-tgtggctacattaagtgcagcacttgcctattggatacggtga
Q568V1_MCL1-01      ttggcgctggtcggatgtgccggtatc-ggcgccggtctggccttcctcatccggtga
Q9I9N3_MCL1-01      ttggcgctggtcggatgtgccggtatc-ggtgccggtctggccttcctcatccggtga
                     *  *  * *   * **** *   **   * ** *  ** ****     ** ******

© 1998-2022Legal notice