Dataset for CDS BCL-2-like of organism Danio rerio

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q564A4_BCL2-01        atggcta--------------acgaaattagctatgacaatcggaatatt
Q568V1_MCL1-01        ------------------------------------atgagcttcctcgc
Q1L8X3_MCL1-01        atggctctgagtttggattttaggcgaacggccacgatgagcttcttcgc
Q9I9N3_MCL1-01        atggctctgagtttggattttaggcgaacggccacgatgagcttcttcgc
Q90Z98_BCL2L1-02      atgtctt----------------actataaccgagaactggtggtatttt
Q90Z98_BCL2L1-01      atgtctt----------------actataaccgagaactggtggtatttt
A2BF68_MCL1-02        at------------------------------------------------
Q8UWD6_MCL1-01        atgt-tc----------------gctggaagaaacaac------------
A2BF68_MCL1-01        atgt-tc----------------gctggaagaaacaac------------
Q568W5_MCL1-01        atgt-tc----------------gctggaagaaacaac------------

Q564A4_BCL2-01        gtggagaaatacctcaagcataaactttcaaagcgaggatatgtgtggaa
Q568V1_MCL1-01        gcag----------ggcgttcaaactccgacgctgaagacgtgcgtcgaa
Q1L8X3_MCL1-01        gcag----------ggcgttcaaactccgacgctaaagacgtgcgtcgaa
Q9I9N3_MCL1-01        gcag----------ggcgttcaaactccgacgctaaagacgtgcgtcgaa
Q90Z98_BCL2L1-02      ttat----------caaatataaactctcgca-gaggaactacccctgca
Q90Z98_BCL2L1-01      ttat----------caaatataaactctcgca-gaggaactacccctgca
A2BF68_MCL1-02        --------------------------------------------------
Q8UWD6_MCL1-01        ----------------------------------gacaacggcttttggc
A2BF68_MCL1-01        ----------------------------------gacaacggcttttggc
Q568W5_MCL1-01        ----------------------------------gacaacggcttttggc

Q564A4_BCL2-01        atgtcagt-------------------------cctctgctgaggaagat
Q568V1_MCL1-01        gacgaactggacgggtacattgaggaggaggaggcgcctctgaagcggct
Q1L8X3_MCL1-01        gacgaactggacggatacattgaggaggaggaggcgcctctgaagcggct
Q9I9N3_MCL1-01        gacgaactggacggatacactgaggaggaggaggcgcctctgaagcggct
Q90Z98_BCL2L1-02      accacattggacttac------------agaagacacaaatcggactgat
Q90Z98_BCL2L1-01      accacattggacttac------------agaagacacaaatcggactgat
A2BF68_MCL1-02        --------------------------------------------------
Q8UWD6_MCL1-01        catgcactgga-ttac------------aaagcaaaccactggttattcc
A2BF68_MCL1-01        catgcactgga-ttac------------aaagcaaaccactggttattcc
Q568W5_MCL1-01        catgcactgga-ttac------------aaagcaaaccactggttattcc

Q564A4_BCL2-01        gacaccttcaataaa---------------gcagtggaggaatcctctcc
Q568V1_MCL1-01        tagacctggtacaaacggcctgaaggggctgcagctggacggtcgatttg
Q1L8X3_MCL1-01        tagaccgggtacaaacggcctgaaggggctgcagctggacggtcgatttg
Q9I9N3_MCL1-01        tagaccgggtacaaacggcctgaaggggctgcagctggacggtcgatttg
Q90Z98_BCL2L1-02      ggggctg------aagagaatggcgagggggcagcaggagcgacaactct
Q90Z98_BCL2L1-01      ggggctg------aagagaatggcgagggggcagcaggagcgacaactct
A2BF68_MCL1-02        ------------------------------------g--------attct
Q8UWD6_MCL1-01        agaactg-----aaagcgcataaccagtttgcggtgg--------actct
A2BF68_MCL1-01        agaactg-----aaagcgcataaccagtttgcggtgg--------actct
Q568W5_MCL1-01        agaactg-----aaagcgcataaccagtttgcggtgg--------actct
                                                          *          *  

Q564A4_BCL2-01        aaactctgacaggaggcttcaggctccctcagccggcggagggaacaact
Q568V1_MCL1-01        tttctacgacagacggatctctaccgaccacccca--gatccagaggagc
Q1L8X3_MCL1-01        tttctgcgacagacggatctctaccgaccacccca--gatccggaggagc
Q9I9N3_MCL1-01        tttctgcgacagacggatctctaccgaccacccca--gatccggaggagc
Q90Z98_BCL2L1-02      tgtt--------aa----tggcaccat----------gaatagaacgaac
Q90Z98_BCL2L1-01      tgtt--------aa----tggcaccat----------gaatagaacgaac
A2BF68_MCL1-02        ct------------------------------------------------
Q8UWD6_MCL1-01        ctcc--------agggctcggtaccgtcctcgccttcggacgaaacgggg
A2BF68_MCL1-01        ctcc--------agggctcggtaccgtcctcgccttcggacgaaacgggg
Q568W5_MCL1-01        ctcc--------agggctcggtaccgtcctcgccttcggacgaaacgggg

Q564A4_BCL2-01        ctgaatgc------------------------------------------
Q568V1_MCL1-01        tcgactacgccga-----------------------------actggaac
Q1L8X3_MCL1-01        tcgactacgccga-----------------------------actggaac
Q9I9N3_MCL1-01        tcgactacgccga-----------------------------actggaac
Q90Z98_BCL2L1-02      gctagttcc---------------------------------actgggac
Q90Z98_BCL2L1-01      gctagttcc---------------------------------actgggac
A2BF68_MCL1-02        --------------------------------------------------
Q8UWD6_MCL1-01        gattatccccccaccgcccttgacatggacacgcgggagattattgacac
A2BF68_MCL1-01        gattatccccccaccgcccttgacatggacacgcgggagattattgacac
Q568W5_MCL1-01        gattatccccccaccgcccttgacatggacacgcgggagattattgacac

Q564A4_BCL2-01        -------ctgatagcccgggtcactcgttcagaccctcattt--------
Q568V1_MCL1-01        gcgatactcggcagctc---ttattggatttttaccgcacacacacggga
Q1L8X3_MCL1-01        gcgatactcggcagctc---ttattggatttttaccgcacacacacggga
Q9I9N3_MCL1-01        gcgatactcggcagctc---ttattggatttttaccgcacacacacggga
Q90Z98_BCL2L1-02      ccca---ccacaatccc---ctgcttcatcc---ccccagcgtcaaacaa
Q90Z98_BCL2L1-01      ccca---ccacaatccc---ctgcttcatcc---ccccagcgtcaaacaa
A2BF68_MCL1-02        -------------------------ggactc---tttc------------
Q8UWD6_MCL1-01        tttc---ttaaaaatct---ttacaggactc---cctcattctaaaagtg
A2BF68_MCL1-01        tttc---ttaaaaatct---ttacaggactc---cctcattctaaaagtg
Q568W5_MCL1-01        tttc---ttaataatct---ttacaggactc---cctcattctaaaagtg

Q564A4_BCL2-01        ----------gaggctctac----------------------------cg
Q568V1_MCL1-01        atgtgtccggtagaccgtaaactccatcacgccataccgacgatgaagcg
Q1L8X3_MCL1-01        atgtgtccggtagaccgtaaactccatcacgccataccgacgatgaagcg
Q9I9N3_MCL1-01        atgtgtccggtagaccgtaaactccatcacgccataccgacgatgaagcg
Q90Z98_BCL2L1-02      atgggtctgggggtctagac-------------------gcagtgaagga
Q90Z98_BCL2L1-01      atgggtctgggggtctagac-------------------gcagtgaagga
A2BF68_MCL1-02        --------------------------------------------------
Q8UWD6_MCL1-01        gacgaaaacaagtactgtca-------------------acaatgaggcg
A2BF68_MCL1-01        gacgaaaacaagtactgtca-------------------acaatgaggcg
Q568W5_MCL1-01        gacgaaaacaagtactgtca-------------------acaatgaggcg

Q564A4_BCL2-01        ggtgttacgggatgctggagatgaaatagaaaggatttaccaacgcgaat
Q568V1_MCL1-01        ggtggtcgacaatattctcgtgaagcaccagat------------cgcat
Q1L8X3_MCL1-01        agtggtcgacaatattctcgtgaagcaccagat------------cgcat
Q9I9N3_MCL1-01        agtggtcgacaatattctcgtgaagcaccagat------------cgcat
Q90Z98_BCL2L1-02      ggcgctccgtgattctgccaacgagtttgagctgcgctattccagagcat
Q90Z98_BCL2L1-01      ggcgctccgtgattctgccaacgagtttgagctgcgctattccagagcat
A2BF68_MCL1-02        --------------------------------------------------
Q8UWD6_MCL1-01        ggttgtggacaatctcgcggtgaagcacgagct------------cgctt
A2BF68_MCL1-01        ggttgtggacaatctcgcggtgaagcacgagct------------cgctt
Q568W5_MCL1-01        ggttgtggacaatctcgcggtgaagcacgagct------------cgctt

Q564A4_BCL2-01        ttgaggaaatgtcccaacaaatggtgttcaacccaaattctgcgcaacgc
Q568V1_MCL1-01        acaaaggaatgatccagcgtcttcag----------ctggactctcagcc
Q1L8X3_MCL1-01        acaaaggaatgatccagcgtcttcag----------ctggactctcagcc
Q9I9N3_MCL1-01        acaaaggaatgatccagcgtcttcag----------ctggactctcagcc
Q90Z98_BCL2L1-02      tcaacgatctttcctcacagctccacatcacacccgccacagcgtaccag
Q90Z98_BCL2L1-01      tcaacgatctttcctcacagctccacatcacacccgccacagcgtaccag
A2BF68_MCL1-02        ----aggtatgattgcacggctgaat----------ctggagcagaaagg
Q8UWD6_MCL1-01        acaaaggtatgattgcacggctgaat----------ctggagcagaaagg
A2BF68_MCL1-01        acaaaggtatgattgcacggctgaat----------ctggagcagaaagg
Q568W5_MCL1-01        acaaaggtatgattgcacggctgaat----------ctggagcagaaagg
                           *   *       *   *                            

Q564A4_BCL2-01        ag-------------ctttctaaccgtggccgaagagctctttagagacg
Q568V1_MCL1-01        ggcctctctggacttcatcagatgtatagcaagcaccatgtttaaagatg
Q1L8X3_MCL1-01        ggcctctctggacttcatcagatgtatagcaagcaccatgtttaaagatg
Q9I9N3_MCL1-01        ggcctctctggacttcatcagatgtatagcaagcaccatgtttaaagatg
Q90Z98_BCL2L1-02      ag-------------cttcgagagcgtgatggatgaggtgtttcgcgacg
Q90Z98_BCL2L1-01      ag-------------cttcgagagcgtgatggatgaggtgtttcgcgacg
A2BF68_MCL1-02        agaagatgtaagtttcatcaagcaagtggcaacagagctctttagcgatg
Q8UWD6_MCL1-01        agaagatgtaagtttcatcaagcaagtggcaacagagctctttagcgatg
A2BF68_MCL1-01        agaagatgtaagtttcatcaagcaagtggcaacagagctctttagcgatg
Q568W5_MCL1-01        agaagatgtaagtttcatcaagcaagtggcaacagagctctttagcgatg
                       *             * *        *           * ***   ** *

Q564A4_BCL2-01        gagtg---aactgggggcggatcattgcattcttcgagtttggtgggacc
Q568V1_MCL1-01        gcgtcactaactggggccgaatcgcgagtctggtggcgttcggggccgtg
Q1L8X3_MCL1-01        gcgtcactaactggggccgaattgcgagtctggtggcgttcggggccgtg
Q9I9N3_MCL1-01        gcgtcactaactggggccgaatcgcgagtctggtggcgttcggggccgtg
Q90Z98_BCL2L1-02      gcgtc---aactggggccgaatcgtggggttgttcgcattcggaggggct
Q90Z98_BCL2L1-01      gcgtc---aactggggccgaatcgtggggttgttcgcattcggaggggct
A2BF68_MCL1-02        gcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatg
Q8UWD6_MCL1-01        gcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatg
A2BF68_MCL1-01        gcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatg
Q568W5_MCL1-01        gcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatg
                      *       ******** ** **        *  *    ** ** *     

Q564A4_BCL2-01        atgtgcgtggaaa-gcgtcaaccgg---gagatggcgtcccaggtagata
Q568V1_MCL1-01        gtttgct----ctcgattgaaggagctccagcaggatcagtgtgtggaga
Q1L8X3_MCL1-01        gtttgct----ctcgattgaaggagctccagcaggatcagtgtgtggaga
Q9I9N3_MCL1-01        gtttgct----ctcgattgaaggagctccagcaggatcagtgtgtggaga
Q90Z98_BCL2L1-02      ctgtgcgtcgagt-gtgtggagaag---gagatgagtccgcttgtgggac
Q90Z98_BCL2L1-01      ctgtgcgtcgagt-gtgtggagaag---gagatgagtccgcttgtgggac
A2BF68_MCL1-02        ctgtgcaaataccagaatgacagag---gacat-agcaagtatgtgaggt
Q8UWD6_MCL1-01        ctgtgcaaataccagaatgacagag---gacat-agcaagtatgtgaggt
A2BF68_MCL1-01        ctgtgcaaataccagaatgacagag---gacat-agcaagtatgtgaggt
Q568W5_MCL1-01        ctgtgcaaataccagaatgacagag---gacat-agcaagtatgtgaggt
                       * ***        *  *      *    *             **     

Q564A4_BCL2-01        atattgcacactggatgactgactacctgaacgggccactg----gaaaa
Q568V1_MCL1-01        gagtggctgagcagatctcctcatatctgacctcagaacag----cagga
Q1L8X3_MCL1-01        gggtggctgagcagatctcctcatatctgacctcagaacag----cagga
Q9I9N3_MCL1-01        gggtggctgagcagatctcctcatatctgacctcagaacag----cagga
Q90Z98_BCL2L1-02      gcatcgcagaatggatgac----cgtctacctagacaaccatattcaacc
Q90Z98_BCL2L1-01      gcatcgcagaatggatgac----cgtctacctagacaaccatattcaacc
A2BF68_MCL1-02        tggtaggggaggagatctcgtcttatctacttacagagcag----cggga
Q8UWD6_MCL1-01        tggtaggggaggagatctcgtcttatctacttacagagcag----cggga
A2BF68_MCL1-01        tggtaggggaggagatctcgtcttatctacttacagagcag----cggga
Q568W5_MCL1-01        tggtaggggaggagatctcgtcttatctacttacagagcag----cggga
                         * *   *   ***  *       **          *           

Q564A4_BCL2-01        ctggatcgaggaaaatggaggttgggatgccttcgtggagatgtacggtc
Q568V1_MCL1-01        ctggatcctcaaaaacaagagctgtcatgggttcgtggagtttttccacc
Q1L8X3_MCL1-01        ctggatcctcaaaaacaagagctggcatgggttcgtggagtttttccacc
Q9I9N3_MCL1-01        ctggatcctcaaaaacaagagctggcatgggtttgtggagtttttccacc
Q90Z98_BCL2L1-02      ctggatccaaagccaaggaggatgggaacgctttgcagagatcttt----
Q90Z98_BCL2L1-01      ctggatccaaagccaaggaggatgggaacgctttgcagagatcttt----
A2BF68_MCL1-02        ctggatactcagaaacaaagcatgggatggctttgtggagttttttcatg
Q8UWD6_MCL1-01        ctggatactcagaaacaaagcatgggatggctttgtggagttttttcatg
A2BF68_MCL1-01        ctggatactcagaaacaaagcatgggatggctttgtggagttttttcatg
Q568W5_MCL1-01        ctggatactcagaaacaaagcatgggatggctttgtggagttttttcatg
                      ******        *       **  *    ** *  *** * *      

Q564A4_BCL2-01        -----agcagagagact-ctgtgttccacccgttttc-----atacctaa
Q568V1_MCL1-01        aggaggacgtagagtctgttgtccgtcat--------------ggtctgt
Q1L8X3_MCL1-01        aggaggacgtagagtctgttgtccgtcat--------------ggtctgt
Q9I9N3_MCL1-01        aggaggatgtagagtctgttgtccgtcat--------------ggtcttt
Q90Z98_BCL2L1-02      -----ggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttc
Q90Z98_BCL2L1-01      -----ggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttc
A2BF68_MCL1-02        tcccggatacagaggcagctgtgagaaac-------------acacttct
Q8UWD6_MCL1-01        tcccggatacagaggcagctgtgagaaac-------------acacttct
A2BF68_MCL1-01        tcccggatacagaggcagctgtgagaaac-------------acacttct
Q568W5_MCL1-01        tcccggatacagaggcagctgtgagaaac-------------acacttct
                                ***  *    *                          *  

Q564A4_BCL2-01        caaaagtgctcgg-cttggcggcgctgggcttggcaggagtg--accatc
Q568V1_MCL1-01        tggcgctggtcggatgtgccggtatc------------ggcgccggtctg
Q1L8X3_MCL1-01        tggcgctggtcggatgtgccggtatc------------ggtgccggtctg
Q9I9N3_MCL1-01        tggcgctggtcggatgtgccggtatc------------ggtgccggtctg
Q90Z98_BCL2L1-02      aagaaatggttg--tttgcaggaatgaccttgctcacgggtgtcgtcgtt
Q90Z98_BCL2L1-01      aagaaatggttg--tttgcaggaatgaccttgctcacgggtgtcgtcgtt
A2BF68_MCL1-02        aacaattggtgg--tgtggctacatta-----------agtgcagcactt
Q8UWD6_MCL1-01        aacaattggtag--tgtggctacatta-----------agtgcagcactt
A2BF68_MCL1-01        aacaattggtgg--tgtggctacatta-----------agtgcagcactt
Q568W5_MCL1-01        aacaattggtgg--tgtggctacatta-----------agtgcagcactt
                            ** * *    **                     * *      * 

Q564A4_BCL2-01        ggagccttttttgctcagaa------gtga
Q568V1_MCL1-01        gccttcctcatc------------cggtga
Q1L8X3_MCL1-01        gccttcctcatc------------cggtga
Q9I9N3_MCL1-01        gccttcctcatc------------cggtga
Q90Z98_BCL2L1-02      gggggactcattgcacagaaacgcctgtga
Q90Z98_BCL2L1-01      gggggactcattgcacagaaacgcctgtga
A2BF68_MCL1-02        g-----cctattggata-------cggtga
Q8UWD6_MCL1-01        g-----cctattggata-------cggtga
A2BF68_MCL1-01        g-----cctattggata-------cggtga
Q568W5_MCL1-01        g-----cctattggata-------cggtga
                      *         *               ****

© 1998-2020Legal notice