Dataset for CDS BCL2L2 of organism Theropithecus gelada

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8D2FJU1_BCL2L2-      atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtc-
A0A8D2FJU1_BCL2L2-      atggcgaccccagcctcggccccagacaca-cgggctctggtggcagact
A0A8D2FJU1_BCL2L2-      atggcgaccccagcctcggccccagacaca-cgggctctggtggcagact
                        ****** *  * **  ****  ***   ** ****  ***  *** * * 

A0A8D2FJU1_BCL2L2-      ---ggggctccgggccggggcggcggcgccatcttgtgcccggggccggt
A0A8D2FJU1_BCL2L2-      ttgtaggttataagctgaggcagaagggtta---tgtctgtggagctggc
A0A8D2FJU1_BCL2L2-      ttgtaggttataagctgaggcagaagggtta---tgtctgtggagctggc
                             ** *    ** * *** *  * *  *   ***    ** ** ** 

A0A8D2FJU1_BCL2L2-      ----ggggaggccggggagggggccccggggggcgcaggggactacggga
A0A8D2FJU1_BCL2L2-      cccggggagggcccagcagctgaccc-----gctgcaccaagccatgcgg
A0A8D2FJU1_BCL2L2-      cccggggagggcccagcagctgaccc-----gctgcaccaagccatgcgg
                            ***  ****  * **  * ***     *  ***     * * * * 

A0A8D2FJU1_BCL2L2-      acggcctg----gagtctgaggaactggagcctgaggagctgct----gc
A0A8D2FJU1_BCL2L2-      gcagctggagatgagttcga-gacccgcttccggcgcaccttctctgatc
A0A8D2FJU1_BCL2L2-      gcagctggagatgagttcga-gacccgcttccggcgcaccttctctgatc
                         * **  *    ****  ** ** * *   ** * * * ** **     *

A0A8D2FJU1_BCL2L2-      tggagcccgagccg-----gagcccgagccc-gaagaggagc----cgcc
A0A8D2FJU1_BCL2L2-      tggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
A0A8D2FJU1_BCL2L2-      tggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
                        *** * *  *** *     ** ***  ** * * * ** * *    * **

A0A8D2FJU1_BCL2L2-      ccggcccc------gcgcccccccgggagctccgg--------gccctg-
A0A8D2FJU1_BCL2L2-      caggtctccgatgaacttttccaagggggccccaactggggccgccttgt
A0A8D2FJU1_BCL2L2-      caggtctccgatgaacttttccaagggggccccaactggggccgccttgt
                        * ** * *       *    **  *** ** **          *** ** 

A0A8D2FJU1_BCL2L2-      ggcctggttcg-----ggagc--ccccggcagccaagag-------gagg
A0A8D2FJU1_BCL2L2-      agccttctttgtctttggggctgcactgtgtgctgagagtgtcaacaagg
A0A8D2FJU1_BCL2L2-      agccttctttgtctttggggctgcactgtgtgctgagagtgtcaacaagg
                         ****  ** *     ** **  * * *   **  ****        ***

A0A8D2FJU1_BCL2L2-      aggaggagcc------gggac--------tggtcgagggtgac---ccgg
A0A8D2FJU1_BCL2L2-      agatggaaccactggtgggacaagtgcaggagtggatggtggcctacctg
A0A8D2FJU1_BCL2L2-      agatggaaccactggtgggacaagtgcaggagtggatggtggcctacctg
                        **  *** **      *****          ** ** **** *   ** *

A0A8D2FJU1_BCL2L2-      gggacggcgc-------------------cattgaggac-----------
A0A8D2FJU1_BCL2L2-      gagacgcggctggctgactggatccacagcagtgggggctggttatccca
A0A8D2FJU1_BCL2L2-      gagacgcggctggctgactggatccacagcagtgggggctgg--------
                        * ****  **                   ** ** ** *           

A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      gatcactgaagctgagatggctgatgaagtaatttgcagtgaaattttaa
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
                                                                          

A0A8D2FJU1_BCL2L2-      -----------------------------------ccggagctggaagct
A0A8D2FJU1_BCL2L2-      gcgactgtgactctgctccaagttccccagatctcgaggagctggaagct
A0A8D2FJU1_BCL2L2-      -----------------------------------gcggagt--------
                                                             ****         

A0A8D2FJU1_BCL2L2-      atcaaagctcgagtcagggagatggaggaagaagctgagaagctaaagga
A0A8D2FJU1_BCL2L2-      atcaaagctcgagtcagggagatggaggaagaagctgagaagctaaagga
A0A8D2FJU1_BCL2L2-      -tcacagctctatacgggg-------------------------------
                         *** ***** *  * ***                               

A0A8D2FJU1_BCL2L2-      gctacagaacgaggtagagaagcagatgaatatgagtccacctccaggca
A0A8D2FJU1_BCL2L2-      gctacagaacgaggtagagaagcagatgaatatgagtccacctccaggca
A0A8D2FJU1_BCL2L2-      --------acgggg------------------------------------
                                *** **                                    

A0A8D2FJU1_BCL2L2-      atgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcc
A0A8D2FJU1_BCL2L2-      atgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcc
A0A8D2FJU1_BCL2L2-      ---------------------ccctggaggaggcg-cggcgtctg-----
                                             ** * ******  *  ** * ***     

A0A8D2FJU1_BCL2L2-      cgttccatctatgttggcaatgtggactatggtgcaacagcagaagagct
A0A8D2FJU1_BCL2L2-      cgttccatctatgttggcaatgtggactatggtgcaacagcagaagagct
A0A8D2FJU1_BCL2L2-      -------------------------------------cgggaggggaact
                                                             * * **  ** **

A0A8D2FJU1_BCL2L2-      ggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactct
A0A8D2FJU1_BCL2L2-      ggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactct
A0A8D2FJU1_BCL2L2-      gg------------------------------------------------
                        **                                                

A0A8D2FJU1_BCL2L2-      gtgacaaatttagtggccatcccaaaggatttgcgtatatagagttctca
A0A8D2FJU1_BCL2L2-      gtgacaaatttagtggccatcccaaaggatttgcgtatatagagttctca
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
                                                                          

A0A8D2FJU1_BCL2L2-      gacaaagagtcagtgaggacttccttggccttagatgagtccctatttag
A0A8D2FJU1_BCL2L2-      gacaaagagtcagtgaggacttccttggccttagatgagtccctatttag
A0A8D2FJU1_BCL2L2-      ------gcatcagtgaggac------------------------------
                              *  ***********                              

A0A8D2FJU1_BCL2L2-      aggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatca
A0A8D2FJU1_BCL2L2-      aggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatca
A0A8D2FJU1_BCL2L2-      ---------------agtg-------------------------------
                                        ***                               

A0A8D2FJU1_BCL2L2-      gcacaacagaccggggttttccacgagcccgctaccgcgcccggaccacc
A0A8D2FJU1_BCL2L2-      gcacaacagaccggggttttccacgagcccgctaccgcgcccggaccacc
A0A8D2FJU1_BCL2L2-      ------ctgacggggg----------------------------------
                              * *** ****                                  

A0A8D2FJU1_BCL2L2-      aactacaacagttcccgctctcgattctacagtggttttaacagcaggcc
A0A8D2FJU1_BCL2L2-      aactacaacagttcccgctctcgattctacagtggttttaacagcaggcc
A0A8D2FJU1_BCL2L2-      -----------------------------ccgtggc----actgggggcc
                                                     * ****     ** *  ****

A0A8D2FJU1_BCL2L2-      ccggggtcgtgtctacaggggccgggctagagcgacatcatggtattccc
A0A8D2FJU1_BCL2L2-      ccggggtcgtgtctacaggggccgggctagagcgacatcatggtattccc
A0A8D2FJU1_BCL2L2-      ctg-----gtaactgtaggggcc--------------------ttttttg
                        * *     **  **  *******                    * **   

A0A8D2FJU1_BCL2L2-      cttac---taa
A0A8D2FJU1_BCL2L2-      cttac---taa
A0A8D2FJU1_BCL2L2-      ctagcaagtga
                        **  *   * *

© 1998-2023Legal notice