Dataset for CDS BCL2L1 of organism Myripristis murdjan

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A667Y1V0_BCL2L1-      atgtcatacagtaacagagaactggtggttttctttataaactataaact
A0A667ZHE8_BCL2L1-      atgtc---ccaaaacagagaactggtggttttctacataacctataaact
                        *****   *   **********************  **** *********

A0A667Y1V0_BCL2L1-      gtctcagaggaactatcccacttgtcagctggggctggaggaggccagcg
A0A667ZHE8_BCL2L1-      ctcccagaggaactatcctttcaaccacatcgggctcatagagtccccaa
                         ** **************       **  * *****    *** **    

A0A667Y1V0_BCL2L1-      aaaggactgagggagacgacgccgacgc--------------------cg
A0A667ZHE8_BCL2L1-      acaggactgatggggggcaggcaggggcggccgaggaacagcgggtagcg
                        * ******** ** *   * ** *  **                    **

A0A667Y1V0_BCL2L1-      tcatct-ctaatggctcactggccaacagcagga--ccgg------cgcc
A0A667ZHE8_BCL2L1-      acacatgccaacgggacact---caacggcacgagtccgggcaccccgcc
                         **  * * ** **  ****   **** *** **  ****      ****

A0A667Y1V0_BCL2L1-      ggc----------cagccggggacgccgtcgcctccgtacggcg-gcata
A0A667ZHE8_BCL2L1-      ggcatcgcccttgcggcgggagcggtcggcgtc----cacgacgagcctg
                        ***          * ** ** *  * ** ** *     *** ** ** * 

A0A667Y1V0_BCL2L1-      gaggtcgttaaggctgcgcttcaggaatcggcggatgagtttgaactgcg
A0A667ZHE8_BCL2L1-      gacgcggtgaaggaggccctgcgggactcggccaacgagttcgagctgcg
                        ** *  ** ****  ** ** * *** *****  * ***** ** *****

A0A667Y1V0_BCL2L1-      ctacacgcaggcgttcagcagcctctcctcccagctccacatcacccccg
A0A667ZHE8_BCL2L1-      ttacgcccgcgccttcaacgacttgcacgaccagctgcacatcacgccgg
                         *** * *  ** **** *  * *   *  ****** ******** ** *

A0A667Y1V0_BCL2L1-      ccacagcctaccacagctttgagagcgtaatggacgaggtgtttcggaac
A0A667ZHE8_BCL2L1-      ccacggcctaccagagcttcgagagcgtgatggatgaggtgttccgggac
                        **** ******** ***** ******** ***** ******** *** **

A0A667Y1V0_BCL2L1-      ggagtcaactgggggcgggtggtgggcctgtttgccttcgggggcgccct
A0A667ZHE8_BCL2L1-      ggcgtcaactggggacgcgtggtcgggctgttcgcgttcggcggcgcgct
                        ** *********** ** ***** ** ***** ** ***** ***** **

A0A667Y1V0_BCL2L1-      ctgtgtggagtgtgtggagagggatatgaaccagctggtgccccgcattg
A0A667ZHE8_BCL2L1-      gtgcgtcgagtgcgtggagaaggagatgagtccgctggtgtcaaggatcg
                         ** ** ***** ******* *** ****  * ******* *  * ** *

A0A667Y1V0_BCL2L1-      cagactggatgaccacgtaccttgataaccacattgagccatggatccag
A0A667ZHE8_BCL2L1-      ccgagtggatgacagtctacctggacaaccacatccagccctggatccac
                        * ** ********    ***** ** ********  **** ******** 

A0A667Y1V0_BCL2L1-      agggaaggaggctgggaccgcttcgctgagatttacgggcgagacgccgc
A0A667ZHE8_BCL2L1-      agccaaggaggatgggaacgctttgccgagatctacgggcaggacgcggc
                        **  ******* ***** ***** ** ***** *******  ***** **

A0A667Y1V0_BCL2L1-      tgcagaggcgaggagagctcaggagagtctaaggagatggctgctggttg
A0A667ZHE8_BCL2L1-      ggcagagggcaggagggctcaggagagcttcaggaagtggctgctggccg
                         *******  ***** ***********  * ****  **********  *

A0A667Y1V0_BCL2L1-      gcgtggtgctgctcacaggcgtgctgctcggcgctctcatcgcaaagaaa
A0A667ZHE8_BCL2L1-      ggatgaccctggtcaccggagtcgtcgtggggtcgcttatcgcccagaag
                        *  **   *** **** ** **  *  * **  * ** *****  **** 

A0A667Y1V0_BCL2L1-      catccctga
A0A667ZHE8_BCL2L1-      cgcctgtga
                        *  *  ***

© 1998-2021Legal notice