Dataset for CDS BAX-like of Organism Aquila chrysaetos chrysaetos

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A663EB63_BOK-01       atgg-------------aggtgctacgcc---gttcctcagtctttgctg
A0A663F127_BAK1-01      atggcctcagggaacgacggtgacccaccgagggcccacagac---gccg
A0A663F127_BAK1-02      atggcctcagggaacgacggtgacccaccgagggcccacagac---gccg
                        ****              ****   * **   *  ** *** *   ** *

A0A663EB63_BOK-01       cagaggtgatgg----aggtttttgacaggtctcccact-----------
A0A663F127_BAK1-01      gggaagcaacaggcgcaggctgtc-acaagagctcaactcagaagaccag
A0A663F127_BAK1-02      gggaagcaacaggcgcaggctgtc-acaagagctcaactcagaagaccag
                          ** *  *  *    *** * *  *** *    * ***           

A0A663EB63_BOK-01       ---------gacaaggagcttgtgtcccaagccaaggctctctgcagaga
A0A663F127_BAK1-01      gtggtggaggagacggaggaggtgtttcggagctatgccttctaccgcta
A0A663F127_BAK1-02      gtggtggaggagacggaggaggtgtttcggagctatgccttctaccgcta
                                 ** * ****   ****  *    * * **  *** * *  *

A0A663EB63_BOK-01       cta---------------------------------cataaattcaaggc
A0A663F127_BAK1-01      ccaacaggagagagaggagagaggggaggaggtgcccatggacccagaga
A0A663F127_BAK1-02      ccaacaggagagagaggagagaggggaggaggtgcccatggacccagaga
                        * *                                 ***  *  **  * 

A0A663EB63_BOK-01       taattcgagcgggtgtcagctggagcaaacctgagtgcaatgcaccagt-
A0A663F127_BAK1-01      ttgtg-----gagatccagcaggagc---------tgggcagcaccggga
A0A663F127_BAK1-02      ttgtg-----gagatccagcaggagc---------tgggcagcaccggga
                        *  *      * *   **** *****         **    ***** *  

A0A663EB63_BOK-01       gcctggtggtaag----ctggccg----aggtgtccaccatact----gc
A0A663F127_BAK1-01      gcctggtaggaaggcgcctggccatcatcggtgacgacattaataagcgg
A0A663F127_BAK1-02      gcctggtaggaaggcgcctggccatcatcggtgacgacattaataagcgg
                        ******* * ***    ******      **** * **  ** *    * 

A0A663EB63_BOK-01       tgcgactagggg-------atgagctggaatacattcgcccc--------
A0A663F127_BAK1-01      tacgatgcggagtttcgctacatgctgaaatccttgcagcccaccaagga
A0A663F127_BAK1-02      tacgatgcggagtttcgctacatgctgaaatccttgcagcccaccaagga
                        * ***   ** *       *   **** *** * * *  ***        

A0A663EB63_BOK-01       -aacgtctaccggaatattgcccgccaattgaacatctcgctgcactcag
A0A663F127_BAK1-01      gaacgtctatgagcacttcaccag--aat--agcctccagct-tgttcga
A0A663F127_BAK1-02      gaacgtctatgagcacttcaccag--aat--agcctccagct-tgttcga
                         ********   * *  *  ** *  ***  * * **  ***    **  

A0A663EB63_BOK-01       agacggtggtgacggacgcc-----------ttcctgg----cagtagct
A0A663F127_BAK1-01      gagcggcattaactggggccgggtgattgcgctgctgggtttcggctacc
A0A663F127_BAK1-02      gagcggcattaactggggccgggtgattgcgctgctgggtttcggctacc
                           ***   * ** *  ***            * ****    * *   * 

A0A663EB63_BOK-01       gcgcagattttcactgcaggcatcacgtggggcaaggttgtgtctctcta
A0A663F127_BAK1-01      gcatggccatccacgtctaccagcac--ggcacaagg----ggtttcctc
A0A663F127_BAK1-02      gcatggccatccacgtctaccagcac--ggcacaagg----ggtttcctc
                        **   *   * ***  *   ** ***  **  *****    *  *  ** 

A0A663EB63_BOK-01       tgctgtggcagctg----ggctggcagtggactgtgtgcggcatgcacag
A0A663F127_BAK1-01      tactggatcacccgctacgtctcggagt------------tcatgctccg
A0A663F127_BAK1-02      tactggatcacccgctacgtctcggagt------------tcatgctccg
                        * ***   ** * *    * ** * ***             ***** * *

A0A663EB63_BOK-01       ccagc-catggttcacaccattgtagattgcct----gggagagtttgtc
A0A663F127_BAK1-01      caaccgcatcgccca-------gtggatcgcccagcagggaggatgggtg
A0A663F127_BAK1-02      caaccgcatcgccca-------gtggatcgcccagcagggaggatgggtg
                        * * * *** *  **       ** *** ***     *****  *  ** 

A0A663EB63_BOK-01       cgcaag-----------------accttggtgacgtggctgaaaaggaga
A0A663F127_BAK1-01      --------------------------------------------------
A0A663F127_BAK1-02      agccagcgggagcgcggggctgtcccggggggaattcggggacaagggga
                                                                          

A0A663EB63_BOK-01       ggaggctg----------ggcagacatcacaaaatgtgtggtgaa----t
A0A663F127_BAK1-01      ----gctgcactcgagctggacaatgtt----tacatgaagtaca----t
A0A663F127_BAK1-02      ggcagccgtgctccggccggtgaacggtgcagcccggggagtacggcact
                            ** *          **   *             *  **       *

A0A663EB63_BOK-01       actgaccccagccttcgctctcactggctcgtggcagctgtttgcagctt
A0A663F127_BAK1-01      gctggtggtgg---tgg-----ccctggtcatggtggggcatttagtggt
A0A663F127_BAK1-02      gctgcggtcgg---tggggttacccgggtgccggcagagca---------
                         ***      *   * *      *  * *   **  *             

A0A663EB63_BOK-01       tggtcacttcctcaaggctatcttcttcgtcctgctgcccgagagatga
A0A663F127_BAK1-01      acgacgcttcttcaggc---cc------------------------taa
A0A663F127_BAK1-02      gcaac-ctggcccaggcagatc------------------------taa
                            * **    ** *     *                        * *

© 1998-2023Legal notice