Dataset for CDS BCL-2 of organism Sphenodon punctatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8D0L5Z6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sphenodon punctatus GN=BCL-2 (length=654 residues).
atggctcatcctgggagaagaagctatgataacagggagatagtgctgaggtacatccattacaaactgtcacagagagg
atatgactgggcttccagcagagatggagcaagtgtcccttctgctgctacgggcacttcctctgaccatggtgggctgg
tgtctttgccccctgagcctcctggctcagctgctgctaataatgtgccctctgatgatgcactaaacccagtactacag
gctgttcacctgactctctgccatgctggtgacgaagtttcccgccgataccagagggatttttcccagatggctggccg
gttgcttttgatcccttttgctgccagggagagctttatggaagtggcagaagagctgttccgagatggggttaactggg
ggaggatcgtggccttccttgaatttggtggcatgatgtgtgtggagagtgttaaccgggagatgtcaccccttgtggac
agcattgctgtatggatgaccgagtacctgaacagacacctgcacaactggatcgaggacaatggaggctgggtatgtgg
ctatatgcatatgcagcctattgtatgcatttggtttatgcaagttaaaatattacagtacttagtttttattatcacat
catcatgtagttag
© 1998-2023Legal notice