Dataset for CDS Unclassified of Organism Calidris pygmaea

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C3JDY1_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Calidris pygmaea (length=447 residues).
atgtctcaaatgagtagagtcccccggcactttgtcctctccagctaccccaatggagcaccagaagaggaaacctacag
taacctccgaacaatcccagacaccgcagagcaaatggagtttaatatcagctcagccacccaggttggtcatcagctgg
ccctgatcggggatgaatttgacaggaggtaccacaggaagtttgaagatacactgcgtcacctggcacgtggggttgct
atcagtgttttccagacatggaatattattaaaagtgttataagaagctttggaaatactttgaacaataactggacaaa
gaggatcattggttatggaagctggatttgcaagcttcctttcaggtgcatctgccagaaggtggtgcctgcagccttgc
tcgttgttgccttttggtgggccatgaattatggactgctgaattaa
>gnl|bcl2dbcds|A0A8C3JSW8_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Calidris pygmaea (length=387 residues).
cttattgaaaaagtggggtgtctggaccccaaagagtttttctcccaagtggccaccaagatgttcgccaacggcacctg
caactgggaccgcgtgggcaccatcttctatcttgcctataaactggtgatgaaggctctttgcctccaaaaccccaagt
tggtgaggaccatcctggaagagaccatgaagatcctgcgggggcacgtcctgggctgggtccaggctcaaggaggatgg
gtaaaaagagccgggggggggtggaataaagtgggggcgggggggcagggaaaaaggggggggtgcaaaaataagggggt
ggcagagcattttggatcttccccttcctcggcaccgggaggtttttctggccccaaagagtcttga
© 1998-2023Legal notice