Dataset for CDS BAX-like of Organism Erpetoichthys calabaricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4SAA5_BOK-01       ------atggagatgcttcgaagatc--ttcagtttttgcagcagaggtg
A0A8C4RFL5_BAK1-01      -atggcaacagggggtgaggaagaccccttcagttcaaacaatcgagaag
A0A8C4T7F8_BAX-01       -atggcatattcagccccggaagatgagtatggatgttcttgtgctgaag
A0A8C4T7F8_BAX-02       -atggcatattcagccccggaagatgagtatggatgttcttgtgctgaag
A0A8C4SXA2_BAX-01       acttctacaattag--cggaaagacagatactggtgtt--tttcatttat
A0A8C4XH90_BAX-01       ----------------------------tactgttttttctctcgtttct
                                                    *   * *               

A0A8C4SAA5_BOK-01       atggaggcatt-------------tgatcgctcaccgactgacaag----
A0A8C4RFL5_BAK1-01      acaaca--attcccaaaatcagcctgattctgaggagcaggttatagagg
A0A8C4T7F8_BAX-01       gtggtg--atc----aagtcag--tgaacaagctgaagttgtcttg----
A0A8C4T7F8_BAX-02       gtggtg--atc----aagtcag--tgaacaagctgaagttgtcttg----
A0A8C4SXA2_BAX-01       gtt-----att----ttattca--tgattacg-------tgtctca----
A0A8C4XH90_BAX-01       attgca--gtt----ttatcca--cgatcgtg-------tgtctcg----
                                 *               **             *         

A0A8C4SAA5_BOK-01       -------gaacttgtttcccaagcaaaggcattgtgccgagactatataa
A0A8C4RFL5_BAK1-01      agactgagagtgtgttttgcagttatgtctttcatcgttaccagcaagaa
A0A8C4T7F8_BAX-01       ----cgtggatatattttacagtcg-atgaggcatgacaattgtccag--
A0A8C4T7F8_BAX-02       ----cgtggatatattttacagtcg-atgaggcatgacaattgtccag--
A0A8C4SXA2_BAX-01       ----cgaaagtgagttaaactctga-atttgatccgatttcggtacag--
A0A8C4XH90_BAX-01       ----tga-----agcagcactcaca-ggatcatatggt------------
                                           *                              

A0A8C4SAA5_BOK-01       actccaggcttaacaaagcaggacttggctggtcc--aagtcagagc---
A0A8C4RFL5_BAK1-01      agtcaaacagaagaaggtgaggtaccaaaggaccctgagattttggacct
A0A8C4T7F8_BAX-01       gtgtgaacatcagtgcagaagatttgggtggatctcaaagtgaaagt---
A0A8C4T7F8_BAX-02       gtgtgaacatcagtgcagaagatttgggtggatctcaaagtgaaagt---
A0A8C4SXA2_BAX-01       cttcg------------------------ggaccccaggcatgaaaa---
A0A8C4XH90_BAX-01       ------------------------------gatct----------ga---
                                                      *  *                

A0A8C4SAA5_BOK-01       atgggctatctggagggtcgctcagggaggtctcctcagttcttttgt--
A0A8C4RFL5_BAK1-01      gcagcccaggttatacagcactccttaccgtgtcggtcaccagttagcca
A0A8C4T7F8_BAX-01       acaaatcccgaagtaaaggacatagtacgaagt----------ttgatac
A0A8C4T7F8_BAX-02       acaaatcccgaagtaaaggacatagtacgaagt----------ttgatac
A0A8C4SXA2_BAX-01       ac----------------------------tct-----------taaaca
A0A8C4XH90_BAX-01       ac----------------------------tgt----------ctaagaa
                                                        *           *     

A0A8C4SAA5_BOK-01       ggctaggtgat---------gagctggaatatcttcgaccaaatgtctac
A0A8C4RFL5_BAK1-01      taattggtgat---------gatat---------------caacagacgt
A0A8C4T7F8_BAX-01       aaattggagat---------gaact---------------aagcag----
A0A8C4T7F8_BAX-02       aaattggagat---------gaact---------------aagcag----
A0A8C4SXA2_BAX-01       aacttgttgacatttcaaagaggtt---------------agatgg----
A0A8C4XH90_BAX-01       aaattggtgac---------gagtt---------------ggatgg----
                           * *  **              *                         

A0A8C4SAA5_BOK-01       cgcaatgtagctcgtcagctcaacattaa-----------tgcaaccttg
A0A8C4RFL5_BAK1-01      tacgaccatgagttcagaagaatgctctcccagttggcactc--acccct
A0A8C4T7F8_BAX-01       --gaacactgaacttgagtaccttattgatcacattgaa-tttagctcag
A0A8C4T7F8_BAX-02       --gaacactgaacttgagtaccttattgatcacattgaa-tttagctcag
A0A8C4SXA2_BAX-01       --tgatgaagaacttcagcaattaattaacgacg------tccaaccaag
A0A8C4XH90_BAX-01       --caacatggagcttcagcaaatgattaacagctcagctcttcaaccaaa
                            *    *               *              *    *    

A0A8C4SAA5_BOK-01       gagaatg-----ttgtttcggatgcatttcttgctgtagcaggagagatg
A0A8C4RFL5_BAK1-01      caaaatgcctacatttac--------ttctgcaagatagccacaagcctc
A0A8C4T7F8_BAX-01       cacag-g-----aagttt--------tta-atattgtggccaagagaatt
A0A8C4T7F8_BAX-02       cacag-g-----aagttt--------tta-atattgtggccaagagaatt
A0A8C4SXA2_BAX-01       cagggag-----acattc--------ctacaggttgcacatcagttattt
A0A8C4XH90_BAX-01       caaagag-----gtgttc--------ttccaggttgcagctcagatgttc
                         *    *        *           *                    * 

A0A8C4SAA5_BOK-01       tttgcaacaggcatcacatggggaaaagtggtctctctctatgctgtggc
A0A8C4RFL5_BAK1-01      tttgagtcagagatcaattggggccgagtgattgccttgctcggttttgg
A0A8C4T7F8_BAX-01       tttgaagatggaattaactggggcagagtggtcgccctttttcattttgc
A0A8C4T7F8_BAX-02       tttgaagatggaattaactggggcagagtggtcgccctttttcattttgc
A0A8C4SXA2_BAX-01       tgtaatggaaatttgaactggggccgcctgatagctttattttactttgc
A0A8C4XH90_BAX-01       agtgatggtaaattaaactggggacgcatagttgcattattctattttgc
                          *          * *  *****     *  *  *  *        * * 

A0A8C4SAA5_BOK-01       aggtggacttgctgtggactgtgtacgacaaggtcagccagctattgtgc
A0A8C4RFL5_BAK1-01      gtaccgaatggctctgcatgtcttccagcaag-----gaataaccggttt
A0A8C4T7F8_BAX-01       ttacaaactaatatgcaaggccataacttcaaattgcaaagagatggtta
A0A8C4T7F8_BAX-02       ttacaaactaatatgcaaggccataacttcaaattgcaaagagatggtta
A0A8C4SXA2_BAX-01       ctgtaaattggcaatgaaggctttaaggcagaaagccgaagaaattgtga
A0A8C4XH90_BAX-01       ctgcaagttggtgatgaaggctttagtgacaaaatttccagaaatggtga
                                *        *     *               *      **  

A0A8C4SAA5_BOK-01       acactattgtggactgcctgggggagtt---------tgtcagaaagaca
A0A8C4RFL5_BAK1-01      cttaagccagat--tggccgattcattgctgactttctccttcgcaatcg
A0A8C4T7F8_BAX-01       gaagagtaatgtactgggc-attaggat---------tttttaggacccg
A0A8C4T7F8_BAX-02       gaagagtaatgtactgggc-attaggat---------tttttaggacccg
A0A8C4SXA2_BAX-01       catgtataatatcatggacaattaatta---------tatcaggga---g
A0A8C4XH90_BAX-01       ggacaatcatcacctggaccattgacta---------cctccatga---g
                                      **                             *    

A0A8C4SAA5_BOK-01       cttagccca---tggctgaagaagcgtggaggctggg-------cagata
A0A8C4RFL5_BAK1-01      gattgctcag--tggattgcacaacaaggtggatgggttgctgttttaga
A0A8C4T7F8_BAX-01       catttcctgg--tgggttagagaacaaggaggatggatgttgacgagcaa
A0A8C4T7F8_BAX-02       catttcctgg--tgggttagagaacaaggaggatggg-------gagcag
A0A8C4SXA2_BAX-01       catctgcttatttggatcatggatcagggtggttggg-------agggaa
A0A8C4XH90_BAX-01       catttgctgaattggatcagggatcagggtggttggg-------agggaa
                          *         *** *     * *  ** ** ***              

A0A8C4SAA5_BOK-01       tcaagcaa------------------tgcgtagtcaacaacgaccccagt
A0A8C4RFL5_BAK1-01      tttggacaatgtctacttgaagtacatgtttgccctgt------------
A0A8C4T7F8_BAX-01       taagcaaaaggtat-cgctgaaaaccaccgaaaacaaaaacagcaaaaaa
A0A8C4T7F8_BAX-02       t---tcaaagctat-tt----------tcaaagtctgaactggccaaacg
A0A8C4SXA2_BAX-01       tcctctca---ta----taatcaatctttgtggcctacagtag-------
A0A8C4XH90_BAX-01       tacggtca---tat-tttggtacacctacctggcagacagtag-------
                        *      *                                          

A0A8C4SAA5_BOK-01       -----------------------------------------ttccagtcc
A0A8C4RFL5_BAK1-01      -----------------------------------------ttgctgtgg
A0A8C4T7F8_BAX-01       aaaaaaaagtacaaggaaagttcgaagaaagaaaaaaaaatgtacaatgt
A0A8C4T7F8_BAX-02       -----------------------------------------ttgcactgt
A0A8C4SXA2_BAX-01       -----------------------------------------gtg---tgt
A0A8C4XH90_BAX-01       -----------------------------------------gtg---ttt
                                                                  *    *  

A0A8C4SAA5_BOK-01       cactggttagtgtccacagtatatacctgtgggcactttgtgaaggcact
A0A8C4RFL5_BAK1-01      tttttttgggacatatcattctgaagc-----------------------
A0A8C4T7F8_BAX-01       ttctgtttggggatcgttgtgcacaac-----------------------
A0A8C4T7F8_BAX-02       ttgtagctgga-------gtcctcact-----------------------
A0A8C4SXA2_BAX-01       tcatagcggga-------gtcataacg-----------------------
A0A8C4XH90_BAX-01       tcttagctgga-------gtacttacc-----------------------
                           *     *         *    *                         

A0A8C4SAA5_BOK-01       ggtgctttacctcctcagagaacgc--tga
A0A8C4RFL5_BAK1-01      gcttcttccgc-------------tcatga
A0A8C4T7F8_BAX-01       tgagct---gcat-----------ccatag
A0A8C4T7F8_BAX-02       ggagctatggcatattggaaaatgtcttaa
A0A8C4SXA2_BAX-01       gcagtggtggccatgcggcgactgtcatga
A0A8C4XH90_BAX-01       acagtacttgtcattcataaaatgtcatga
                                                   *  

© 1998-2023Legal notice