Dataset for CDS BAX-like of Organism Erpetoichthys calabaricus

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A8C4RFL5_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BAK1 (length=645 residues).
atggcaacagggggtgaggaagaccccttcagttcaaacaatcgagaagacaacaattcccaaaatcagcctgattctga
ggagcaggttatagaggagactgagagtgtgttttgcagttatgtctttcatcgttaccagcaagaaagtcaaacagaag
aaggtgaggtaccaaaggaccctgagattttggacctgcagcccaggttatacagcactccttaccgtgtcggtcaccag
ttagccataattggtgatgatatcaacagacgttacgaccatgagttcagaagaatgctctcccagttggcactcacccc
tcaaaatgcctacatttacttctgcaagatagccacaagcctctttgagtcagagatcaattggggccgagtgattgcct
tgctcggttttgggtaccgaatggctctgcatgtcttccagcaaggaataaccggtttcttaagccagattggccgattc
attgctgactttctccttcgcaatcggattgctcagtggattgcacaacaaggtggatgggttgctgttttagatttgga
caatgtctacttgaagtacatgtttgccctgtttgctgtggtttttttgggacatatcattctgaagcgcttcttccgct
catga
>gnl|bcl2dbcds|A0A8C4SAA5_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BOK (length=636 residues).
atggagatgcttcgaagatcttcagtttttgcagcagaggtgatggaggcatttgatcgctcaccgactgacaaggaact
tgtttcccaagcaaaggcattgtgccgagactatataaactccaggcttaacaaagcaggacttggctggtccaagtcag
agcatgggctatctggagggtcgctcagggaggtctcctcagttcttttgtggctaggtgatgagctggaatatcttcga
ccaaatgtctaccgcaatgtagctcgtcagctcaacattaatgcaaccttggagaatgttgtttcggatgcatttcttgc
tgtagcaggagagatgtttgcaacaggcatcacatggggaaaagtggtctctctctatgctgtggcaggtggacttgctg
tggactgtgtacgacaaggtcagccagctattgtgcacactattgtggactgcctgggggagtttgtcagaaagacactt
agcccatggctgaagaagcgtggaggctgggcagatatcaagcaatgcgtagtcaacaacgaccccagtttccagtccca
ctggttagtgtccacagtatatacctgtgggcactttgtgaaggcactggtgctttacctcctcagagaacgctga
>gnl|bcl2dbcds|A0A8C4SXA2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BAX (length=534 residues).
acttctacaattagcggaaagacagatactggtgtttttcatttatgttattttattcatgattacgtgtctcacgaaag
tgagttaaactctgaatttgatccgatttcggtacagcttcgggaccccaggcatgaaaaactcttaaacaaacttgttg
acatttcaaagaggttagatggtgatgaagaacttcagcaattaattaacgacgtccaaccaagcagggagacattccta
caggttgcacatcagttattttgtaatggaaatttgaactggggccgcctgatagctttattttactttgcctgtaaatt
ggcaatgaaggctttaaggcagaaagccgaagaaattgtgacatgtataatatcatggacaattaattatatcagggagc
atctgcttatttggatcatggatcagggtggttgggagggaatcctctcatataatcaatctttgtggcctacagtaggt
gtgttcatagcgggagtcataacggcagtggtggccatgcggcgactgtcatga
>gnl|bcl2dbcds|A0A8C4T7F8_BAX-01 BCL2-associated X gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BAX (length=651 residues).
atggcatattcagccccggaagatgagtatggatgttcttgtgctgaaggtggtgatcaagtcagtgaacaagctgaagt
tgtcttgcgtggatatattttacagtcgatgaggcatgacaattgtccaggtgtgaacatcagtgcagaagatttgggtg
gatctcaaagtgaaagtacaaatcccgaagtaaaggacatagtacgaagtttgatacaaattggagatgaactaagcagg
aacactgaacttgagtaccttattgatcacattgaatttagctcagcacaggaagtttttaatattgtggccaagagaat
ttttgaagatggaattaactggggcagagtggtcgccctttttcattttgcttacaaactaatatgcaaggccataactt
caaattgcaaagagatggttagaagagtaatgtactgggcattaggattttttaggacccgcatttcctggtgggttaga
gaacaaggaggatggatgttgacgagcaataagcaaaaggtatcgctgaaaaccaccgaaaacaaaaacagcaaaaaaaa
aaaaaagtacaaggaaagttcgaagaaagaaaaaaaaatgtacaatgtttctgtttggggatcgttgtgcacaactgagc
tgcatccatag
>gnl|bcl2dbcds|A0A8C4T7F8_BAX-02 BCL2-associated X gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BAX (length=597 residues).
atggcatattcagccccggaagatgagtatggatgttcttgtgctgaaggtggtgatcaagtcagtgaacaagctgaagt
tgtcttgcgtggatatattttacagtcgatgaggcatgacaattgtccaggtgtgaacatcagtgcagaagatttgggtg
gatctcaaagtgaaagtacaaatcccgaagtaaaggacatagtacgaagtttgatacaaattggagatgaactaagcagg
aacactgaacttgagtaccttattgatcacattgaatttagctcagcacaggaagtttttaatattgtggccaagagaat
ttttgaagatggaattaactggggcagagtggtcgccctttttcattttgcttacaaactaatatgcaaggccataactt
caaattgcaaagagatggttagaagagtaatgtactgggcattaggattttttaggacccgcatttcctggtgggttaga
gaacaaggaggatggggagcagttcaaagctattttcaaagtctgaactggccaaacgttgcactgtttgtagctggagt
cctcactggagctatggcatattggaaaatgtcttaa
>gnl|bcl2dbcds|A0A8C4XH90_BAX-01 BCL2-associated X gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BAX (length=483 residues).
tactgttttttctctcgtttctattgcagttttatccacgatcgtgtgtctcgtgaagcagcactcacaggatcatatgg
tgatctgaactgtctaagaaaaattggtgacgagttggatggcaacatggagcttcagcaaatgattaacagctcagctc
ttcaaccaaacaaagaggtgttcttccaggttgcagctcagatgttcagtgatggtaaattaaactggggacgcatagtt
gcattattctattttgcctgcaagttggtgatgaaggctttagtgacaaaatttccagaaatggtgaggacaatcatcac
ctggaccattgactacctccatgagcatttgctgaattggatcagggatcagggtggttgggagggaatacggtcatatt
ttggtacacctacctggcagacagtaggtgttttcttagctggagtacttaccacagtacttgtcattcataaaatgtca
tga
© 1998-2023Legal notice