Dataset for CDS BCL2A1 of organism Panthera tigris altaica

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C9KZ34_BCL2A1-      atggcggatggcgagtttgggtacgttctcacgctggcccgggactatac
A0A8C9KZ34_BCL2A1-      atggcggatggcgagtttgggtacgttctcacgctggcccgggactatac

A0A8C9KZ34_BCL2A1-      gaagcacgttctgcaggggccccagcccgggtgccacccaagcagagtat
A0A8C9KZ34_BCL2A1-      gaagcacgttctgcaggggccccagcccgggtgccacccaagcagagtat

A0A8C9KZ34_BCL2A1-      cccaagtgctacaagacgtggccttctcggtccagggggaggtcgagaag
A0A8C9KZ34_BCL2A1-      cccaagtgctacaagacgtggccttctcggtccagggggaggtcgagaag

A0A8C9KZ34_BCL2A1-      cagctgaagccgtgcctggacaagttccacgtggggtcggtagacacggc
A0A8C9KZ34_BCL2A1-      cagctgaagccgtgcctggacaagttccacgtggggtcggtagacacggc

A0A8C9KZ34_BCL2A1-      caggacgatgttccaccaagtgatggagaaggaatttgaagacggcatca
A0A8C9KZ34_BCL2A1-      caggacgatgttccaccaagtgatggagaaggaatttgaagacggcatca

A0A8C9KZ34_BCL2A1-      tcaactggggcaggattgtgactatatttgcgtttgagggcatcctcatc
A0A8C9KZ34_BCL2A1-      tcaactggggcaggattgtgactatatttgcgtttgagggcatcctcatc

A0A8C9KZ34_BCL2A1-      aagaagcttctccaggagcggatcgtcccagacgcggatgcgttcaaggt
A0A8C9KZ34_BCL2A1-      aagaagcttctccaggagcggatcgtcccagacgcggatgcgttcaaggt

A0A8C9KZ34_BCL2A1-      ttcctacttcgttgccgagttcatcacgaaacacacgggagaatggatcc
A0A8C9KZ34_BCL2A1-      ttcctacttcgttgccgagttcatcacgaaacacacgggagaatggatcc

A0A8C9KZ34_BCL2A1-      ggcaaaacggaggctgggaaaacggctttgtaaggaagttcgaa-cccaa
A0A8C9KZ34_BCL2A1-      ggcaaaacggaggctgg--aggcgtttcc-----gaagtgtgaagcacaa
                        *****************  *  **  *       *****  *** * ***

A0A8C9KZ34_BCL2A1-      gt--ctggctggctgacctttctggaagttacaggaaagatctgtaaggt
A0A8C9KZ34_BCL2A1-      gcagcgaggggacagaacctccctga------------------------
                        *   *  *  * * ** * * *  **                        

A0A8C9KZ34_BCL2A1-      attgtctctcctgaagaactactactga-----
A0A8C9KZ34_BCL2A1-      ---gtctctc----acatcctctgcttcgttag
                           *******    * * *  ** **       

© 1998-2023Legal notice